Labshake search
Citations for Addgene :
201 - 250 of 2504 citations for Monocyclohexyl Phthalate 100 Ug Ml In Mtbe Ring 1 2 13C2 Dicarboxyl 13C2 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... dUP-Cd63 and dUP-Myt1l (2 mg/ml, subcloned from double UP mClover to Scarlet, Addgene #125134, Taylor et al., BioRxiv 2019); DFRS ...
-
bioRxiv - Cell Biology 2021Quote: ... LifeAct mScarlet cell lines were generated by electroporating 2 μg/ml of pLifeAct-mScarlet-N1 plasmid DNA (a gift from Dorus Gadella, Addgene plasmid 85054) into WT and CD56-KO NK92 cells using the Amaxa nucleofector (Kit R ...
-
bioRxiv - Neuroscience 2021Quote: ... C57BL/6J mice received unilateral injections of AAVrg-CaMKIIα-mCherry (200 nl at 200 nl/min, titer 2×1013 vg/ml, #114469-AAVrg, Addgene, MA, USA) into the right main OB (0.5 mm lateral from midline ...
-
bioRxiv - Immunology 2019Quote: ... AAV carrying Cre-dependent tdTomato cassette (AAV2/1.CAG.Flex.tdTomato.WPRE.bGH, titer ≥1013 vg/mL, Addgene) was injected into the iLN Nav1.8Cre/+ animals as described above ...
-
bioRxiv - Neuroscience 2020Quote: ... oChIEF was manufactured by Virovek (AAV2/1.CAG.flex.oChIEF.tdTomato, Addgene 30541, 2.2×1013 GC/ml). For anatomical experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 4.5 × 1013 GC/ml (Cat # AV-1-ALL864, RRID:Addgene_51503; U Penn Vector Core).
-
bioRxiv - Neuroscience 2023Quote: ... and CamKII-Cre (pENN.AAV.CamKII 0.4.Cre.SV40, titer≥1×10¹³ vg/ml Addgene 105558-AAV9) virus was injected in S1 barrel cortex ...
-
bioRxiv - Neuroscience 2024Quote: ... we unilaterally injected 450 nL AAV9-hSyn-flex-GCaMP7s (≥ 1×10¹³ vg/mL, Addgene)107 into lAcbSh ...
-
bioRxiv - Cancer Biology 2023Quote: ... Sequences (shPROX1-1: TGCTGTTGACAGTGAGCGCGAGGACCAAGATGTCATCTCATAGTGAAGCCACAGATGTATGAGATGAC ATCTTGGTCCTCATGCCTACTGCCTCGGA; shPROX1-2: TGCTGTTGACAGTGAGCGCCCCCGAGAAAGTTAC AGAGAATAGTGAAGCCACAGATGTATTCTCTGTAACTTTCTCGGGGATGCCTACTGCCTCGGA) were cloned into the LT3GEPIR backbone100 (Addgene; 111177) and used to generate lentiviral particles to transduce into organoids as described99 ...
-
bioRxiv - Cancer Biology 2023Quote: ... A CRISPR/dCas9 vector was constructed as follows: pX330A_dCas9-1×2 (Addgene, Watertown, MA; plasmid ID 63596) (20 ...
-
bioRxiv - Plant Biology 2023Quote: ... fw2.2-sgRNA-1 and fw2.2-sgRNA-2 were fused to the Arabidopsis AtU6-26 promoter (Addgene #46968) by digestion-ligation reaction in plCH47751 (Addgene #48002 ...
-
bioRxiv - Neuroscience 2021Quote: ... was mixed 1:1 with the retrogradely trafficked AAV encoding eGFP (AAVrg-hsyn-EGFP, 7.4 × 1012 vg/mL; Addgene, Watertown, MA) and infused into the BLA (AP ...
-
bioRxiv - Neuroscience 2021Quote: 50 nL of AAV1 particles (titer 1 × 1012 cfu mL−1) produced from pAAV-EF1a-double-floxed-hChR2(H134)-EYFP-WPRE-HGHpA (Addgene.org #20298) was injected into L5 of S1 (co-ordinates from bregma ...
-
bioRxiv - Neuroscience 2021Quote: 50 nl of AAV1 particles (titer 1 × 1012 cfu ml−1) produced from pAAV-EF1a-double-floxed-hChR2(H134)-EYFP-WPRE-HGHpA (Addgene #20298) was injected unilaterally into the L5 of S1 (coordinates from bregma ...
-
bioRxiv - Neuroscience 2022Quote: ... mice (see Table 1) were injected with pAAV9-EF1a-DIO-ChrimsonR-mRuby2-KV2.1-WPRE-8V40 (Addgene, titer: 1×1013 vg/mL) or ssAAV-9/2-hEF1a-dlox-eNpHR3.0_iRFP(rev)-dlox-WPRE-hGHp(A ...
-
bioRxiv - Molecular Biology 2021Quote: The cell cycle reporter vector pCSII-EF-miRFP709-hCdt(1/100) was a kind gift from Vladislav Verkhusha (Addgene plasmid # 80007 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors encoding ChR2(H134R)-eYFP (titer = 1 x 1012 vg/ml, Addgene 26973, RRID:Addgene_127090) were stereotaxically injected into and centered at the temporal association cortex (TeA ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV vectors encoding ChR2(H134R)-eYFP (titer = 1 x 1012 vg/ml, Addgene 26973, RRID:Addgene_127090) were stereotaxically injected into and centered at the temporal association cortex (TeA ...
-
bioRxiv - Neuroscience 2022Quote: pAAV-CAG-tdTomato (titer ≥ 1×10¹³ vg/mL) was a gift from Edward Boyden (Addgene viral prep #59462-AAV9 ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-EF1a-DIO-hChR2(H134R)-EYFP (Addgene, 1.8*10^13 gc/ml, diluted 1:10), AAV2-hSyn-hChR2(H134R)-EYFP (UNC Vector Core ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV2/1-DIO-CAG-GCaMP6f was purchased from Addgene (# 100839, titer: 1.4 × 1013 gc/ml). To chemogenetically activate PVNOT neurons by means of DREADD we employed AAV2/1-DIO-hSYN1-hM3Dq-mCherry (Addgene # 44361 ...
-
bioRxiv - Neuroscience 2024Quote: ... we injected a mix of AAV1.Syn.jGCaMP7f (Addgene 104488; dilution 1:10 ∼ 1x1013 GC/mL) and AAV1.Syn.Flex.tdTomato (Addgene 28306 ...
-
bioRxiv - Cell Biology 2022Quote: ... CRISPR vector pX330A-1×2 was a gift from Takashi Yamamoto (Addgene plasmid # 58766 ; http://n2t.net/addgene:58766 ; RRID:Addgene_58766) (101) ...
-
bioRxiv - Neuroscience 2020Quote: ... from pBS-KS-attB2-SA(0/1/2)-T2A-LexA::QFAD-Hsp70 plasmids (Addgene #62947, #62948 and #62949) (Diao et al. ...
-
bioRxiv - Neuroscience 2021Quote: AAV1/2.hSyn-GFP particles were generated by co-transfection of HEK293T cells with AAV2/1 (Addgene 112862), AAV2/2 (Addgene 104963) ...
-
bioRxiv - Cell Biology 2020Quote: ... dlg-1::mCherry and ebp-2::egfp vectors were cloned using Gibson assembly and vector pJJR82 (Addgene #75027) (Gibson et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... The SARS-CoV-2 Spike ectodomain Hexa-pro construction (Table 1) was a gift from Jason McLellan (Addgene # 154754 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1:5 dilution in saline solution) or AAV1.CAG.DIO.tdTomato (control, 120 nl, 2.6×1013 vg/mL Addgene, diluted 1:5 in saline) was injected into AL ...
-
bioRxiv - Neuroscience 2023Quote: ... 1000 nL of AAV5-CaMKIIa-GCaMP6f was injected into mPFC (diluted 1:1 in DPBS; Addgene, 100834-AAV5, 2.2e12 VG/mL titer). A 1-mm diameter GRIN lens (Inscopix ...
-
bioRxiv - Immunology 2024Quote: ... One microliter of 1:100 diluted product was used for golden gate cloning into lentiCRISPR v2-Puro (Addgene plasmid #52961) using 11 cycles of 5 minutes T4 ligase ligation at 16 °C and 5 minutes of BsmbI digestion at 37 °C ...
-
bioRxiv - Microbiology 2021Quote: ... 8 × 105 293 T cells in a 6 cm dish were cotransfected with 2 μg of HIV-1 packaging plasmid pCMVΔ8.2 R (Addgene # 12263); 0.5 μg of the pCMV-VSV-G plasmid (Addgene # 8454 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Two guides were designed using the http://crispr.mit.edu tool (guide 1: CGGCTACTCCACTGTGGCGG; guide 2: CGCTTCTTGGGCCGGATGAG) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described (55) ...
-
bioRxiv - Genomics 2022Quote: pNLZ10 (Pfib-1::NLS::dCas9::24xGCN4::NLS::tbb-2 3’UTR) construct contains pCFJ150 vector backbone (Addgene plasmid # 19329). SV40 NLS::dCas9::egl-13 NLS: ...
-
bioRxiv - Cancer Biology 2023Quote: ... HEK 293T cells were transfected with either sulfatase 1 or sulfatase 2 expression plasmids or empty vector control derived from pcDNA3.1 (RRID: Addgene_79663) using Lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... We generated monoclonal U2OS cell lines expressing the following fluorescent plasmids: 1) ptfLC3B was a gift from Tamotsu Yoshimori (Addgene plasmid #21074; http://n2t.net/addgene:21074; RRID:Addgene_2107443; 2) pMXs-puro GFP-DFCP1 was a gift from Noboru Mizushima (Addgene plasmid #38269 ...
-
bioRxiv - Cancer Biology 2024Quote: ... GGTGAGGTGGAAATGAGCCA; HK1-3: GGAGGGCAGCATCTTAACCA) and HK2 (HK2-1: GATGCGCCACATCGACATGG; HK2-2: TAAGCGGTTCCGCAAGGAGA) was cloned into lentiCRISPR v2 construct (RRID:Addgene_52961) using a protocol available online (Zhang_lab_LentiCRISPR_library_protocol.pdf) ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were subcultured twice a week at a ratio of 1:5 to 1:8.Transient transfection of HeLa cells (1–2 x 105 cells/6-well) with pcDNA3.1(+) NAPstar or pSC2 HyPer7 (Addgene; plasmid #136466 ...
-
bioRxiv - Immunology 2024Quote: ... the single guide RNA (sgRNA) sequences targeting exon 1 or 2 of murine IFNγR1 were cloned into the pX458 backbone (Addgene) containing Cas9 expression and GFP expression ...
-
bioRxiv - Immunology 2019Quote: ... 1 μl of Adeno-Associated Virus (AAV) (AAV2/1.CMV.HI.eGFP-Cre.WPRE.SV40, titer >=8E+12 vg/mL, Addgene) mixed with 0.5 μl of fast green (Sigma ...
-
bioRxiv - Neuroscience 2021Quote: ... and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL, Addgene, Catalog # 26969-AAV5).
-
bioRxiv - Immunology 2022Quote: ... and Bach2 ORF (Origene, MR224703 cloned into Addgene, Cat# 52107, 1 μg/ml, marked by GFP) using the X-tremeGENE transfection reagent (Sigma Aldrich ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-CAG-Flex.GCaMP6f.WPRE (3.15×1013 vg/ml, working dilution 1:10, Addgene plasmid #100835-AAV5; http://www.addgene.org/100835/; RRID:Addgene_100835) was a gift of Douglas Kim and GENIE Project ...
-
bioRxiv - Neuroscience 2022Quote: ... adeno-associated virus AAV8 carrying CaMKII-GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40. Addgene. #100834. 1×1012 genome copies per ml) was injected with Nanoject-III (Drummond Scientific Company ...
-
bioRxiv - Neuroscience 2023Quote: ... For anterograde transsynaptic tracing: AAV1-hSyn-Cre-WPRE-hGH (1013 gc/ml, Addgene; 1:10 dilution) was injected in DCN (coordinates as above) ...