Labshake search
Citations for Addgene :
301 - 350 of 383 citations for Modified Jis Pcb Alt B Calibration Solution Cs0.4H Unlabeled 13C12 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR product containing CHD4 was cloned into a modified pFastBac vector (a gift from S. Gradia, UC Berkeley, vector 438-C, Addgene: 55220) via LIC ...
-
bioRxiv - Microbiology 2021Quote: ... Lentiviral vectors encoding N-terminal 3xFLAG and V5 tandem tagged versions of BPLF1 aa 1-325 and the corresponding catalytic mutant BPLF1-C61A under control of the doxycycline-inducible pTight promoter were produced by cloning the corresponding open reading frames(Ascherio & Munger, 2015) into ta modified version of the pCW57.1 plasmid (gift from David Root, Addgene plasmid #41393). The Gal1/10 His6 TEV Ura S ...
-
bioRxiv - Immunology 2020Quote: ... Codon-optimized NLRP1 lacking the PYD and CARD (Residues W148-P1364, NLRP1ΔΔ) was subcloned into an in-house modified pcDNA3.1 LIC 6D (Addgene plasmid #30127) vector containing a C-terminal TEV linker ...
-
bioRxiv - Immunology 2021Quote: A lentiviral vector suitable for convenient subcloning between these modified pMY and pMX vectors was made by modifying lentiCRISPR v2 (Addgene: #52961) (Sanjana ...
-
bioRxiv - Biophysics 2020Quote: ... The PCR product containing codon optimized nsp12 was cloned into the modified pFastBac vector 438-C (a gift from S. Gradia, UC Berkeley, Addgene: 55220) via LIC ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA or a tandem cassette of 3 gRNAs targeting FBXL4 was cloned into AAV-U6-gRNA-CAG-mtKeima-WPRE-hGHpA (modified from Addgene, 60229) under the U6 promoter ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference was generated from the mouse genome (GRCm38) and annotation (GRCm38.93) and modified to include the sequences for tdTomato (Addgene plasmid # 22799) (Madisen et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... The annealed oligo products were directionally cloned into a modified version of the gRNA+LbCas12a expression plasmid pTE4398 (Addgene, Watertown, MA) as crRNA genes for sgRNA expression ...
-
bioRxiv - Molecular Biology 2022Quote: ... The fragments are then cloned into a mammalian expression vector containing Flag and mEGFP (N- or C-terminal) (modified from Addgene #32104) using NEBuilder HiFi DNA Assembly kit (E2611) ...
-
bioRxiv - Neuroscience 2023Quote: ... The plasmids used in this study are modified from the pSox2-bd::FP construct (Addgene plasmid #34703; Bestman et al., 2015), a plasmid that contains a weak FGF4 promotor regulated by 6 repeats of the Sox2 transcription factor binding domain ...
-
bioRxiv - Molecular Biology 2023Quote: ... Due to the Purmocyin resistance the XEN-dCas9-BFP-KRAB cells were infected with a modified version of the pLKO5.GRNA.EFS.PAC vector (Addgene, cat. no. 57825) replacing puromycin with blasticidin resistance ...
-
bioRxiv - Genomics 2023Quote: sgRNAs targeting 3 different locations in the genome were cloned into a modified version of pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955), where BFP was replaced by superfolder GFP (sfGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... using in house modified versions of hygromycin-resistant and MiniMos enabled vector pCFJ1662 (gift of Erik Jorgensen, University of Utah, Addgene #51482): pCFJ1662 Phyp7 mNeonGreen GTWY let858 (34B2) ...
-
bioRxiv - Cancer Biology 2023Quote: ... pX330 was sequentially modified to accept a 2.4kb Cas9-P2A-Cre fragment from pSECC (a gift from Tyler Jacks (Addgene plasmid # 60820) first by an EcoRI (New England Biolabs ...
-
bioRxiv - Neuroscience 2023Quote: ... The 40% iodixanol layer after ultracentrifugation was collected and buffer exchanged with DPBS using Amicon Ultra centrifugal filters (#Z648043, Millipore) (modified protocol from Addgene, USA). We performed quantitative PCR on the viral stocks and the titer was determined as approximately 1.9 x 1012 genomic copies/ml for S5E2-lox dTom lox rcGFP lox2 and 1.1 x 1012 genomic copies/ml for S5E2-lox ChR2 mCh lox.
-
bioRxiv - Neuroscience 2024Quote: The pAAV-CMV:Cas9-T2A-mCherry/U6:sgRNA plasmid was modified from pX601 (pAAV-CMV:NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA; Addgene plasmid # 61591). To visualize the AAV-infected cells ...
-
bioRxiv - Cell Biology 2024Quote: ... were generated by RT-PCR from mouse cDNA cloned (details available on request) into a modified doxycycline-inducible lentiviral vector pCW57.1 (a gift from David Root, Addgene plasmid # 41393). 293 [HEK-293] (ATCC® CRL-1573TM ...
-
bioRxiv - Cancer Biology 2024Quote: ... A modified cloning strategy was used to clone the two gRNA into pSpCas9(BB)-2A-Puro vector (Addgene, Watertown, MA, #62988) and described in our previous publication 45 ...
-
bioRxiv - Cell Biology 2024Quote: ... MEFs and MDA-MB-231 cells were stably modified using BFP and DN-KASH expression plasmids in a doxycycline-inducible Piggybac plasmid backbone (Addgene #187019). For lentiviral modifications ...
-
bioRxiv - Biophysics 2021Quote: ... consisting of the human brain isoform B of fyn (confirmed by BLAST alignment) was a gift from Filippo Giancotti (Addgene plasmid # 16032)(Mariotti et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Genetics 2023Quote: ... FlpOM was generated by introducing the human b-globin intron from CreM into a codon optimized Flp (Raymond and Soriano, 2007; Addgene plasmid # 13792), interrupting the coding sequence between amino acids 159 and 160 ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Human GeCKOv2 CRISPR Knockout Pooled Library (A+B) in the lentiGuide-Puro vector backbone (gift from Feng Zhang; Addgene Plasmid # 1000000048) was amplified and purified as directed by Addgene ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus solution (1000 nl, titer ≥1013 vg/ml, #100836-AAV9 from Addgene) was injected in the SCN (ML +/-0.2 ...
-
bioRxiv - Microbiology 2020Quote: ... The resulting amplicons and gene fragment were then cloned into a modified pLenti CMV GFP Puro plasmid (a gift from Eric Campeau & Paul Kaufman; Addgene plasmid #17448), which contains a 3’ WPRE sequence following the insert and a 3’ SV40 polyadenylation signal after the puromycin resistance cassette ...
-
bioRxiv - Cell Biology 2020Quote: To generate the ATF4-SunTag reporter, we have modified the previously-described SunTag-Renilla-MS2 plasmid (Wilbertz et al., 2019) (Addgene plasmid #119945) by inserting the cDNA of human ATF4 5’UTR (until the end of uORF2 ...
-
bioRxiv - Molecular Biology 2021Quote: ... ΔIDR-SHARP) were then recombined into two different modified versions of the doxycycline inducible PiggyBac destination vector PB-TAG-ERN (Addgene plasmid 80476) containing NGFR (truncated human nerve growth factor receptor ...
-
bioRxiv - Molecular Biology 2021Quote: ... was randomly integrated in the genome of the target cell line via lentiviral transduction of a modified version of pHR-SFFV-dCas9-BFP-KRAB (Addgene plasmid # 46911) carrying a P2A blasticidin selection and UCOE element (kind gift of Marvin Tanenbaum) ...
-
bioRxiv - Developmental Biology 2020Quote: ... specific gRNAs targeting the catalytic center of Tet1 and Tet2 were cloned into a modified version of the SpCas9-T2A-GFP/gRNA (px458116, Addgene plasmid #48138), to which we fused a truncated form of human Geminin (hGem ...
-
bioRxiv - Bioengineering 2020Quote: ... The construction of PEgRNA transcript carrying plasmid: The empty PEgRNA plasmid was modified from the pgRNA-bacteria (ColE1 ori, Addgene plasmid #44251)30 by removing the 20 bp spacer ...
-
bioRxiv - Biophysics 2021Quote: ... in fibril gene were mutated to TGG and full-length fibril gene with modified tryptophan codons was cloned into pHIS17 vector (Addgene plasmid #78201) with or without a terminal hexa-histidine (His6 ...
-
bioRxiv - Neuroscience 2022Quote: ... Guide sequence with minimal off target and very high activity score was chosen and cloned into the BbsI restriction site of the Cas9 plasmid (Cas9-P2A-Puro modified from Addgene #62988(30)) ...
-
bioRxiv - Microbiology 2021Quote: ... Michèle Bouloy (Institut Pasteur, France) were induced to overexpress ACE2 using a modified lentiviral expression system (pLV-EF1a-IRES-Neo (Addgene, plasmid 85139)) ...
-
bioRxiv - Genomics 2022Quote: ... In order to integrate CRISPR targets and sgRNAs into the genome, we modified the CROPseq vector (Datlinger et al., 2017) (Addgene ID 86708), which expresses an sgRNA and a PolII transcript ...
-
bioRxiv - Developmental Biology 2021Quote: ... specific gRNAs targeting upstream of the stop codon (Supplementary Table) were cloned into a modified version of the SpCas9-T2A-GFP/gRNA plasmid (px458172, Addgene plasmid #48138), where we fused a truncated form of human Geminin (hGem ...
-
bioRxiv - Developmental Biology 2021Quote: ... specific gRNAs targeting upstream of the stop codon (Supplementary Table) were cloned into a modified version of the SpCas9-T2A-GFP/gRNA plasmid (px458172, Addgene plasmid #48138), where we fused a truncated form of human Geminin (hGem ...
-
bioRxiv - Cell Biology 2020Quote: ... shRNA containing vectors were constructed by ligation of shRNA sequence between the EcoRI and PmeI sites downstream of the U6 promoter of modified pEGFP-U6 vector 36 (a gift from Zuoshang Xu, Addgene plasmid #19799). Target sequence for human MARCKSL1 is 5’-GTGTGAACGGAACAGATGATG-3’ ...
-
bioRxiv - Immunology 2021Quote: ... The S106C mutant of human ASC PYD (aa1-106) was cloned into an in-house modified pET28-MBP-TEV vector (Addgene, plasmid #69929), in which N-terminal His6 tag was added for expression of proteins with a cleavable N-terminal His6-MBP-tag ...
-
bioRxiv - Cell Biology 2022Quote: ... were constructed by cloning the open reading frame (ORF) of human IRF1 or cMYC into a modified pLX303 vector (Addgene plasmid 25897). cDNAs encoding IRF1-SBDmut ...
-
bioRxiv - Cell Biology 2022Quote: ... The TTP stability reporter (pLX-SFFV-mCherry-TTP-P2A-BFP) was constructed by cloning the open reading frame (ORF) of murine TTP into a modified pLX303 vector (Addgene plasmid 25897). Lentiviral N-terminally HA-tagged-TTP deletions or point mutant variants were obtained by cloning the indicated variants of murine TTP ORF into a modified pLX303 vector ...
-
bioRxiv - Neuroscience 2022Quote: ... placed upstream of GFP for histology and gene expression experiments, and upstream of GCaMP7f (Dana et al., 2019) (modified from Addgene plasmid #104495), or a conditional version of GCaMP8s (Zhang et al. ...
-
bioRxiv - Neuroscience 2022Quote: The CRISPRi lentivirus construct was modified from pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP (Addgene #71237, a gift from Charles Gersbach28), which expresses all necessary CRISPRi machinery (both the dCas9-KRAB and sgRNA ...
-
bioRxiv - Microbiology 2023Quote: ... Two gRNA binding sites near the 3’ region of each gene of interest were identified using EuPaGDT Editing of the previously modified pTREX-n-Cas9 plasmid 51 (Addgene plasmid 68708), performed to exchange the previous gRNA sequence was achieved using a Q5 mutagenesis kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2020) were deleted of their hygromycin B resistance gene via Lipofectamine transfection of a plasmid expressing FlpE (Addgene #20733; (Beard et al. 2006)) ...
-
bioRxiv - Cancer Biology 2023Quote: HT29 dCas9-VP64 clone E cells were transduced with lentivirus of Calabrese pooled human CRISPRa library set A and B (Addgene, 92379 and 92380) separately ...