Labshake search
Citations for Addgene :
451 - 500 of 746 citations for MICA Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: Full length wild type human DHX30 cDNA corresponding to transcript (ENST00000348968.8) was cloned into the TetON lentiviral vector pCW57.1 (Addgene), exploiting the Nhe I and Age I restriction endonucleases ...
-
Comparative performance of the BGI and Illumina sequencing technology for single-cell RNA-sequencingbioRxiv - Genomics 2019Quote: Comprised of cultured human trabecular meshwork cells (TMWCs) that had been transfected with a CROP-seq (Addgene: 99248) guide RNA (gRNA ...
-
bioRxiv - Cancer Biology 2020Quote: cDNAs for human prostate cancer TMPRSS2-ERG fusion was cloned into retroviral-based vector MSCV-C-HA (Addgene). Retrovirus was produced in 293T cells by standard methods using Ampho packaging vector ...
-
bioRxiv - Cell Biology 2021Quote: ... The mCh-hRab7A (#922) plasmid encoding mCherry-labeled version of human Rab7A protein was from Addgene (Cat# 61804). GFP-hRab5A.dn3 (#966) ...
-
bioRxiv - Cell Biology 2021Quote: The RFP-hRab5A.dn3 (#921) plasmid encoding RFP-labeled version of human Rab5A protein was from Addgene (Cat# 14437). The mCh-hRab7A (#922 ...
-
bioRxiv - Cancer Biology 2021Quote: U2OS cells harboring Doxycycline-inducible human RNF168 were generated using the pINDUCER20 lentiviral vector (Addgene plasmid # 44012; http://n2t.net/addgene:44012; RRID:Addgene_44012). All cell lines were cultured in DMEM medium supplemented with 10% fetal bovine serum and penicillin–streptomycin (1%) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... human CaV3.2 (a1Ha-pcDNA3 was a gift from Dr E. Perez-Reyes, Addgene #45809 (Cribbs et al. 1998), human CaV3.3 (a1Ic-HE3-pcDNA3 also from Dr E ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... The respective cell lines were subsequently transduced with the human genome-wide CRISPR-KO (GeCKO, Addgene, #1000000048, #1000000049) sgRNA library at a 1000-fold representation and a multiplicity of infection of <0.3 to ensure one sgRNA integration per cell ...
-
bioRxiv - Cancer Biology 2021Quote: All human and mouse melanoma lines were engineered to overexpress Cre under the UBC promoter modified from Addgene plasmid #65727 as described in87 ...
-
bioRxiv - Cell Biology 2020Quote: ... the cDNA of human CAV1 was PCR amplified from the mammalian expression plasmid Emerald-CAV1 C-10 (Addgene No ...
-
bioRxiv - Genetics 2020Quote: ... The expression plasmid for human Nucleolin was constructed by amplifying the NCL ORF from GFP-Nucleolin (Addgene; #28176) using primers NCL-For and NCL-1XHA Rev (Table S1) ...
-
bioRxiv - Microbiology 2021Quote: ... human telomerase (hTERT) was exogenously expressed using pBABE-neo-hTERT (Addgene 1774, a gift from Bob Weinberg ((44)) ...
-
bioRxiv - Neuroscience 2022Quote: ... A135P and wildtype human iPSC-derived NGN2 neurons were transfected with 0.8 µg of Mito7-dsRed (Addgene #55838) and 0.2 µg of pCAG-Venus at day 5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... A2058-dCas9-KRAB cell lines were infected with Stress and Proteostasis-human subpooled sgRNA library (Cat#83973, Addgene), with MOI=0.3 and selected with puromycin (2 μg/mL ...
-
bioRxiv - Microbiology 2022Quote: ... expressing 76,441 sgRNAs against 19,114 human genes + 1,000 non-targeting sgRNA controls in plentiCRISPRv2 was obtained from Addgene (51). The library was electroporated into Endura electrocompetent cells (# 60242 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Cell Biology 2022Quote: ... The human NALCN cDNA and the mCherry cDNAs were subcloned in the pLV-EF1a-IRES-Blast (Addgene #85133) using standard molecular biology techniques.
-
bioRxiv - Molecular Biology 2023Quote: The genome-wide human CRISPR/Cas9 Synergistic Activation Mediator (SAM) sgRNA library (gift from Feng Zhang, Addgene #1000000057) was amplified as recommended ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cell Biology 2023Quote: The human Brunello CRISPR knockout pooled library was a gift from David Root and John Doench (Addgene #73178) (49) ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074; http://n2t.net/addgene:24074; RRID:Addgene_24074). GST-tag HP1⍺ΔC construct was generated by site-direct mutagenesis kit (NEB ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ; http://n2t.net/addgene:103938; RRID:Addgene_103938). Plasmids encoding tethered fusion constructs were custom cloned by Epoch Biosciences (Missouri City ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Cell Biology 2024Quote: ... We next used the human EZH2 primary protein sequence available in the addgene for hEZH2 plasmid (#24230, Addgene) and predicted the possible cysteine residues using the GPS-SNO prediction tools ...
-
bioRxiv - Immunology 2024Quote: ... U87 MG IL13Rα2+ RFP+ cells were generated by stable expression of human IL13Rα2 and RFP (Addgene plasmid #26001) and sorting for RFP and IL13Rα2 expression ...
-
bioRxiv - Cell Biology 2023Quote: ... HeLa cells were co-transfected with pcDNA3.0 plasmids containing human CDC50A (NM_018247, N-terminal FLAG tag; RRID: Addgene_203694) and ATP10B variants (O94823.2 ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049; http://n2t.net/addgene:24049; RRID:Addgene_24049). This construct (hIR ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 7.5 ug of the Human Improved Whole-Genome Knockout CRISPR library V1 (by Kosuke Yuya, Addgene #67989), 18.5 ug of psPax2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... dCas9-expressing cells were then transduced with the Calabrese Human CRISPR Activation Pooled Library (Set A, Addgene, 92379-LV) using enough cells to obtain a library coverage of 500 cells per sgRNA at an MOI of 0.4.17 Selection with puromycin (0.6 μg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and cloned into a bicistronic expression vector (pX330) containing human codon-optimized Cas9 and RNA components (Addgene, #42230). The guide sequences targeting the AMPKα1 gene (PRKAA1 ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
bioRxiv - Genomics 2020Quote: ... Cas9 expressing human melanoma cell line 2686 was transduced with lentiviral particles produced as described above using expression plasmid pXPR_011 (Addgene #59702 ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR Brunello genome-wide knockout library was a gift from David Root and John Doench (Addgene #73178). MelJuSo cells stably expressing FLAG-VGLL3 were generated and two batches of 100 million cells were infected at an MOI of 0.3 ...
-
bioRxiv - Biochemistry 2019Quote: ... a mammalian expression vector pRK5 encoding EGFP tagged wild-type (WT) human tau (pRK5-EGFP-tau, # 46904, RRID: Addgene_46904), which contains four C-terminal repeat regions and lacks the N-terminal sequences (0N4R) ...
-
bioRxiv - Molecular Biology 2020Quote: ... we used the sequence of a human codon optimized Streptococcus pyogenes Cas9 (SpCas9) obtained from pX330-U6-Chimeric_BB-CBh-SpCas9 from Feng Zhang (Addgene plasmid # 42230 ...
-
bioRxiv - Cancer Biology 2020Quote: Human ATG5 knockout P3 and T98G GBM cell lines were generated by using LentiCRISPRv268 (purchased from Addgene, plasmid# 99573). Plasmids were transfected into 293T cells using BBS/CaCl2 to produce lentivirus ...
-
bioRxiv - Cancer Biology 2021Quote: ... full-length human SETDB1 cDNA was cloned into the NotI sites of the pcDNA3.1(+)-IRES-GFP (Addgene; Cat#: 51406). For transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cells used for RNA sequencing were first integrated with Not1-linearized pBABE-neo-hTERT plasmid (Addgene plasmid # 1774) and selected with G418 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341; http://n2t.net/addgene:78341; RRID: Addgene_78341) and mScarlet (Bindels et al. ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Cancer Biology 2022Quote: ... human umbilical vein endothelial cells (HUVECs) were infected with lentivirus constructs for CRISPR/Cas9 (Addgene plasmid #52961, lentiCRISPR v2) induced knock-out for Rbpj35 ...
-
bioRxiv - Molecular Biology 2022Quote: Human Reg3α (hReg3α) lacking the N-terminal inhibitory pro-peptide was expressed and purified from a pET3a vector (Addgene plasmid ID 64937 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The mouse Spdef cDNA and human SPDEF cDNA were synthetized from IDT and cloned into LentiV P2A Blast (Addgene_111887) using Gibson assembly (NEB).
-
bioRxiv - Microbiology 2021Quote: ... The wildtype human HIF1α gene was obtained from pcDNA3-HIF1α plasmid (Addgene 18949, a gift from William Kaelin (45)) ...
-
bioRxiv - Microbiology 2020Quote: The production of high titer Human sgRNA Brunello lentiviral library which contains 4 sgRNA per gene (15) (Addgene #73178), was performed by transfecting HEK293T cells in five 15 cm tissue culture plates using PEI (Polyethylenimin Linear ...
-
bioRxiv - Immunology 2019Quote: ... The sgRNA oligos were annealed and ligated into the human codon-optimized SpCas9 expression plasmid (pX330; Addgene plasmid # 42230), as described previously63 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and a non-human control were amplified from the pSB700 plasmid and cloned into PB-TRE-dCas9_VPR (Addgene #63800) using the following primers ...
-
bioRxiv - Cell Biology 2019Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048)35 and pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230)97 were gifts from Feng Zhang ...