Labshake search
Citations for Addgene :
201 - 250 of 2366 citations for M CHERRY MRNA mCherry Fluorescent Protein coding mRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The mCherry-H37Rv was made using pMSP12: mCherry plasmid (Addgene No. 30169). H37Rv culture was grown in Middlebrook 7H9 (BD ...
-
bioRxiv - Cancer Biology 2019Quote: To obtain stable knockdowns of PTEN and RB (in-house-designed) shRNA sequences targeting specific regions within the respective mRNA were cloned into the lentiviral vector pLVTHM (Addgene#12247) carrying mCherry or GFP as mammalian selection marker ...
-
bioRxiv - Genetics 2020Quote: ... The same kit was used to produce Cas9 D10A mRNA using as template the plasmid pCAG-T3-hCasD10A-pA (Addgene #51638). The 140bp ssDNA homology direct repair (HDR ...
-
bioRxiv - Neuroscience 2021Quote: ... was used to synthesize capped Cas9 mRNA from the pT3TS-nCas9n plasmid (kind gift from Dr Wenbiao Chen; Addgene plasmid # 46757). The synthesized Cas9 mRNA was purified using the RNeasy MinElute Cleanup Kit (Qiagen) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Cas9 mRNA was obtained by in vitro transcription of linearized pT3TS-nCas9n plasmid (a gift from Wenbiao Chen (Addgene plasmid #46757)) using the mMESSAGE mMACHINE T3 kit (Ambion ...
-
bioRxiv - Developmental Biology 2021Quote: Minos transposase mRNA was generated using the ThermoFisher mMESSAGE mMACHINE T7 or T7 ULTRA kit using NotI-digested pBlueSK-MimRNA (Addgene #102535). mRNA and concentrated DNA were mixed into a final concentration of 1 µg/µL in a solution of 0.1% phenol red in nuclease-free water ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cas9-mRNA was in vitro transcribed overnight at 20°C from 400-500 ng XbaI-linearized pT3TS-nCas9n (Addgene, plasmid #46757) using the mMessage mMachine T3 Kit (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... H2B-mCherry (Addgene; 20972) were from Robert Benezra ...
-
bioRxiv - Cell Biology 2020Quote: ... Coronin1B-mCherry (Addgene 27694) and Dynamin2-mCherry (Addgene 27689 ...
-
bioRxiv - Cell Biology 2021Quote: ... ARP3-mCherry (Addgene #27682) and mCherry-cortactin (Addgene #27676 ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-hSyn-mCherry (Addgene) and hSyn-Cre-p2a-dTomato (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... H2B-mCherry (Addgene # 20972) is previously described in (Nam and Benezra ...
-
bioRxiv - Cancer Biology 2022Quote: MSCV-mCherry (Addgene, 52114) was used to generate 20.12DP cells from mCherry− GFP+ 20.12 cells.
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-VAPB (Addgene – 108126), pEGFPC1-hVAP-B KD/MD (Addgene – 104450) ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-Drp1 (Addgene #49152), Tubuline-GFP (Addgene #56450) ...
-
bioRxiv - Developmental Biology 2022Quote: The pLX304 lenti-mCherry-SEpHluorin plasmid was generated by inserting an mCherry-SEpHluorin fragment from an mCherry-SEpHluorin plasmid (Addgene #32001) into lentiviral vector pLX304 (Addgene #25890) ...
-
bioRxiv - Cell Biology 2019Quote: ... and inserted between BsrG-I and Xho-I site of Cherry-LacRep plasmid (from Mirek Dundr: Addgene plasmid #18985) by Gibson Assembly to make mCherry-Kv2.1-WT and mCherry-Kv2.1-∆C318.
-
bioRxiv - Neuroscience 2023Quote: ... coding sequences of GFP-NLS-tetR fusion protein was synthesized and cloned into UAS expression plasmid pJFRC-MUH (Addgene #26213) by GenScript Biotech ...
-
bioRxiv - Neuroscience 2019Quote: ... with different fluorescent protein genes and helper plasmids (3 μg pcDNA-SADB19N (Addgene, 32630), 1.5 μg pcDNA-SADB19P (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... and flp-dependent mCherry (2E13 GC/mL, AAV9-Ef1a-fDIO- mCherry, Addgene 114471) was injected at two sites in the AC (1.3 and 1.7 mm anterior to lambdoid suture at the temporal ridge ...
-
bioRxiv - Cell Biology 2023Quote: ... The mCherry-Cry2 constructs were made by amplifying mCherry-Cry2 DNA from Addgene plasmid #101221 (gift from Brangwynne) ...
-
bioRxiv - Cell Biology 2023Quote: ... For mCherry labelling we replaced eGFP to mCherry from pTK96_mCherry-MRLC2 (Addgene #46358) vector using AgeI and BsrGI sites ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1-cell stage embryos were injected with a 1 nl mix of approximately 56-60 pg sgRNA and 190 pg cas9 mRNA (Addgene plasmid #47322). Mosaic embryos were raised to adulthood and crossed with Tupel Long fin (TL ...
-
bioRxiv - Cell Biology 2019Quote: ... plasmids were then transformed into the strains to enable detection of MS2 and PP7-tagged mRNAs The MS2 and PP7 tagging reagents were gifts from Jeff Gerst and Robert Singer (Addgene #31864 & #35194) (Haim-Vilmovsky and Gerst ...
-
bioRxiv - Cell Biology 2019Quote: ... The TSMod Coding sequence was amplified from Addgene Plamsid # 26021 (Schwartz Lab) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The TagBFP coding sequence was derived from Addgene plasmid #67168 ...
-
bioRxiv - Biophysics 2023Quote: ... The TfR coding sequence was amplified from Addgene plasmid # 133451.
-
bioRxiv - Molecular Biology 2021Quote: We performed a genome-wide CRISPR knock-out (KO) screen using the lentiviral Brie sgRNA library comprising 4 sgRNAs per protein-coding gene (Addgene #73632) (Doench et al. ...
-
bioRxiv - Genomics 2023Quote: ... CROP-seq-opti-Puro-T2A-GFP was assembled by adding a T2A-GFP downstream of Puromycin resistant protein coding sequence on the CROP-seq-opti plasmid (Addgene #106280). Flanking MluI and CsiI digestion sites were added to the GFP Gblock (IDT ...
-
bioRxiv - Developmental Biology 2023Quote: ... The protein coding sequence of H2B was amplified from the pCAG-H2BtdiRFP-IP plasmid obtained from Addgene (Catalog no.47884, Addgene) using KAPA HiFi polymerase (Catalog no ...
-
bioRxiv - Molecular Biology 2021Quote: ... The mCherry expression cassette from pCAGGS-mCherry (a gift from Phil Sharp, Addgene #41583) was inserted between the homology arms ...
-
bioRxiv - Neuroscience 2022Quote: The commercial AAV5-hSynhM3D(Gq)-mCherry or the control virus AAV5-hSyn-mCherry (Addgene) were injected into the sciatic nerve of WT C57BL/6J mice (1μL/sciatic nerve ...
-
bioRxiv - Cell Biology 2022Quote: ... m25 backbone was made by replacing the mCherry sequence in mCherry-CRY2clust (Addgene #105624) with an insert containing inverted BsaI sited followed by 4x(EAAAR ...
-
bioRxiv - Cell Biology 2021Quote: ... SBP-mCherry insert and vector were amplified from Str-KDEL_SBP-mCherry-GPI (Addgene # 65295). The eGFP-Surf4 plasmid (pLV[Exp]-Puro-EF1A>eGFP-3xGS-hSurf4 ...
-
bioRxiv - Cell Biology 2020Quote: ... GW1-Peredox-mCherry (Peredox-mCherry) was a gift from Gary Yellen (Addgene plasmid #32380) [42] ...
-
bioRxiv - Biochemistry 2021Quote: ... pCDNA3-mCherry-SEpHluorin (mCherry-pHluorin) was a gift from Sergio Grinstein (Addgene plasmid #32001)
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-mCherry (Addgene Plasmid #70182) was used to generate stable Cas9-expressing cell lines ...
-
bioRxiv - Cell Biology 2020Quote: ... and Dynamin2-mCherry (Addgene 27689) were gifts from Christien Merrifield [30] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and NLS-mCherry (Addgene #49313) plasmids were obtained from Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... pTriEx-mCherry-zdk1 (Addgene #81057) [46] ...
-
bioRxiv - Bioengineering 2021Quote: ... and CAG-mCherry (Addgene #108685) fragments were PCR-amplified and cloned into the px552 plasmid (Addgene #60958 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV8-hSyn-mCherry (#114472, Addgene) and AAV1-Syn-NES-jRGECO1a-WPRE-SV40 (Penn Vector Core ...
-
bioRxiv - Neuroscience 2021Quote: ... and Ensconsin-mCherry (Addgene, MA). For imaging ER bulk flow trafficking to Golgi ...