Labshake search
Citations for Addgene :
1 - 50 of 744 citations for Locostatin CAS 90719 30 5 100% since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Bioengineering 2023Quote: ... together with tFucci(CA)5 plasmid29 (Addgene #153521), as per manufacture’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... tFucci(CA)5 was a gift from Atsushi Miyawaki (Addgene plasmid # 153521).
-
bioRxiv - Cell Biology 2023Quote: ... The FUCCI adenoviral vector was generated by cloning tFucci(CA)5 (Addgene plasmid #153521) into the pShuttle-CMV vector ...
-
bioRxiv - Cell Biology 2020Quote: ... A glass capillary with a fine tip containing plasmid solution is inserted into the eye primordium of stage 26-30 embryos to inject 8−5-8 nl doses of 1 µg/µl of pEGFPC1-hVAP-A (Addgene #104447) or pEGFPC1-hVAP-A KD/MD (Addgene #104449 ...
-
bioRxiv - Microbiology 2022Quote: ... pJB38-NWMN29-30 (RRID:Addgene_84457), was digested with EcoRV and PCR products inserted by Gibson Assembly (NEB ...
-
bioRxiv - Neuroscience 2024Quote: ... or juvenile (P28-30) Grpr::eGFP mice were injected bilaterally with 250 nL (neonates) or 100 nL (juveniles) AAV5-hSyn-mCherry (Addgene: 114422-AAV5) diluted 1:200 to label neurons in the NAc MSh ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Synthetic Biology 2022Quote: The construction of vectors pCTCON2-BXG (Addgene plasmid #158127),30 pCTCON2-BYG (Addgene plasmid #158144),30 pCHA-Donkey1.1,38 and pCHA-Donkey1.1-H54TAG38 have been described previously ...
-
bioRxiv - Physiology 2021Quote: ... 100 U/ml penicillin and 100 ug/ml streptomycin in a 5% CO2/95% air atmosphere at 37C Plasmid GP-CMV-GCaMP6s (Addgene plasmid # 40753) was cloned into lentiviral vector pCDH-EF1-MCS-IRES (puro ...
-
bioRxiv - Molecular Biology 2024Quote: ... 30 μg of envelope plasmid (VSV-G, Addgene #8454), and 30 μg of transfer plasmid using 270 μl of polyethylene imine (PEI) ...
-
bioRxiv - Cancer Biology 2022Quote: Retroviral pLPCX vectors expressing the mitochondrial or cytoplasmic form of Grx1-roGFP227 and roGFP2-ORP123 were obtained from Addgene (Addgene, Watertwon, CA, USA) and used to transduce FL5.12MycER cells ...
-
bioRxiv - Cancer Biology 2024Quote: pLEX304mNeonGreen (Addgene; CA#162034)
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The MYB-FLAG construct was obtained from Addgene (catalog #66980 [30]).
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Neuroscience 2024Quote: ... PSD-95 (NeuroMab, 1:100 and Addgene 1:100 for SIM experiments), RIM1/2 (SySy ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Cancer Biology 2024Quote: pLBS-mScarlet (Addgene; CA#129337)
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... and FUCCI(CA) (Addgene, 153521). For EB3:tdStayGold ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of CB1-GFP and 100 ng of Rab5-BFP (Addgene #49147) were mixed with 0.2 µL of lipofectamine 2000 following transfection method previously described then added to the wells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of CB1-GFP and 100 ng of R-GECO (Addgene #32444) were mixed with 0.2 µL of lipofectamine 2000 transfection reagent ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Molecular Biology 2020Quote: The expression construct pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene; plasmid # 42230 (30)) for human codon-optimized SpCas9 and a chimeric guide RNA were modified as follows ...
-
bioRxiv - Bioengineering 2021Quote: ... 32] was genetically fused to Red enhanced Nano-lantern (ReNL [30]; Addgene plasmid #89536 ...
-
bioRxiv - Molecular Biology 2024Quote: ... lentiGuide-Puro (30) was a gift from Feng Zhang (Addgene plasmid # 52963). pcDNA-dCas9-p300 Core (14 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2024Quote: ... 100-120nL (Addgene catalog # 26975); and AAV5-CaMKIIa-mCherry (Addgene catalog # 114469) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Cell Biology 2020Quote: ... and pCW57.1-mDux-CA (Addgene, 99284) plasmids were used for lentivirus production.
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2021Quote: ... and AAV packaging plasmid expressing Rep2/Cap5 genes for production of serotype 5 – pAAV2/5 (RRID:Addgene_104964).
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Cell Biology 2024Quote: ... The protospacer sequences are: 5′- TCTCCGCTTCTTCCGCCAGT-3′ and 5′-CCTCATCGAGGAAAAACAGG-3′ (cloned into pX459 from Addgene). CRISPRi knockdown cell lines were generated by lentiviral transduction with plasmids containing individual sgRNAs and selected by puromycin at 2 μg/mL ...
-
bioRxiv - Cancer Biology 2024Quote: AML cell lines were transduced as described above using lentiCRISPRv2-neo (Addgene #98292)100 or lentiCRISPRv2-GFP (Addgene #82416)100 cloned with the gRNAs of interest ...
-
bioRxiv - Plant Biology 2022Quote: ... pICH41402 (Addgene #50285; ΩTMV 5’UTR), pAGM47523 (Addgene #153221 ...
-
bioRxiv - Biophysics 2022Quote: ATG12–5-16L1-GFP constructs (Addgene_169077) were expressed and purified from SF9 cells as described25 (dx.doi.org/10.17504/protocols.io.br6qm9dw) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg of VSV.G (#14888, Addgene) and 5 μg pCL-Eco (#12371 ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/5.EF1a-eYFP.WPRE.hGH (Addgene, titer ≥ 7×10¹2 vg/mL ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 μg pMD2G (12259; Addgene) using Lipofectamine 2000 according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg of pMDLg/pRRE (Addgene 12251 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 μg pRRE (Addgene, plasmid #12251), 2.5 μg pRSV-Rev (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg of psPAX2 (#12260, Addgene), and 5 µg of pMD2.G (#12259 ...