Labshake search
Citations for Addgene :
1 - 50 of 877 citations for LDLR Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 (previously described20) were transduced with lentiviruses carrying dCAS9-10xGCN4 (Addgene 60903) termed HEK293-ACE2-SunTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Neuroscience 2020Quote: ... pEZYmyc-His (Addgene plasmid #18701 ...
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... pEZYmyc-HIS (Addgene, #18701) or pDEST-myc ...
-
bioRxiv - Cancer Biology 2022Quote: ... ITGA2-HIS (Addgene, #51910), ITGB2-YFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... his-hOPTN (Addgene, #23053), mOPTN (mouse tissue cDNA) ...
-
bioRxiv - Cell Biology 2024Quote: ... Eps15-GFP-His (Addgene #170860 ...
-
bioRxiv - Immunology 2021Quote: ... The human full length (HFL) gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537 ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were transfected with pMIB1-FLAG (Addgene# 37116) and pHA-Ub (Addgene# 18712 ...
-
bioRxiv - Systems Biology 2021Quote: ... The pMEL16 (His-, Addgene 107922) and p414-TEF1p-Cas9-CYC1t (hereafter referred to as P414 ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID ...
-
bioRxiv - Bioengineering 2023Quote: HIS-tagged HER2 (Addgene #16257) was expressed using the Expi293™ expression system (Thermo Fisher ...
-
bioRxiv - Cell Biology 2022Quote: HEK293 cell were transfected with pGL3BRE Luciferase (#45126, Addgene®) and pCMV-Renilla luciferase plasmid (Thermofisher #16153) ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were electroporated with plasmid DNA pcDNA3.1/Zeo(+) (Addgene) containing only the Strep-Flag (SF)-tag (mock) ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293 cells transfected with either cmv-gfp (control; Addgene 11153) or cmv-CAPS-FLAG were plated in a 96-well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... pcDNA3.1-Flag-His-ATM (Addgene 31985), pcDNA3.1-mCherry-NLRP3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SERPINE1-bio-his (Addgene #52077) which were gifts from Gavin Wright without signal sequence to prevent cleavage of fused proteins (75) ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139113)
-
bioRxiv - Developmental Biology 2021Quote: pET-28b-RfxCas13d-His (Addgene #141322) plasmid containing the T7 promoter was linearized by using NotI restriction site ...
-
bioRxiv - Developmental Biology 2023Quote: ... pcDNA3.0-BMAL1-His (AddGene CN: 31367), pcDNA3.0-3XFLAG-Cry2 plasmids and PEI max 40k (Polysciences Inc CN ...
-
bioRxiv - Developmental Biology 2023Quote: pcDNA3-BMAL1-His (AddGene CN: 31367) were purchased from the Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293 cells were transfected with 3.0ug pcDNA3.1-hACE2 (Addgene, 145033, USA) plasmids by Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293 cells were transfected with PPRE-H2b-eGFP (59) (Addgene #84393) using Invitrogen Lipofectamine 3000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... of the parental cells (HEK293) with lentiCRISPR v2 plasmid57 (Addgene #52961) containing target specific gRNAs listed in Methods Table 1 ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139112)
-
bioRxiv - Cell Biology 2020Quote: ... and 6x-HIS-tagged-HOXB2 (Addgene 8522) were obtained from commercial vendors and cloned into pCMV6 vector and transfected into HEK cells ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139116)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139117)
-
bioRxiv - Genomics 2020Quote: ... CRISPR-mediating LDLR disruption was performed by cloning the gRNA sequence [AACAAGTTCAAGTGTCACAG] into BsmBI sites of pLentiCRISPRv2 (Addgene #52961, a gift from Feng Zhang[16]) or BbsI sites of pX459 (Addgene #62988 ...
-
bioRxiv - Molecular Biology 2019Quote: ... MmEsco2-myc/his and H2B-mCherry were amplified from the vectors pcDNA3.1/myc-His and pcDNA3-H2B-mCherry (Addgene, 20972), respectively ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The CyPet gene was amplified by PCR from the pCyPet-His vector (pCyPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14030 ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The YPet gene was amplified by PCR from the pYPet-His vector (pYPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14031 ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139124, 139125 respectively)
-
bioRxiv - Biochemistry 2021Quote: ... pFastBac1 His-MBP (#30116) were procured from Addgene. pNIC28-MBP was constructed by replacement of TrxT with MBP [22] ...
-
bioRxiv - Bioengineering 2022Quote: ... the plasmid pET-28b-Cas9-His (Addgene #47327) was transformed into Rosetta (DE3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... the pET-28b-RfxCas13d-His vector (Addgene, Plasmid #141322) was used for RfxCas13d protein production (Bon Opus Biosciences ...
-
bioRxiv - Biochemistry 2020Quote: ... The FLAG-His sequence in payload plasmid pKM491 (Addgene) was replaced with sequence for a 3×FLAG tag by Gibson Assembly (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139126, 139127, 139128)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139114, 139115 respectively)
-
bioRxiv - Cell Biology 2023Quote: ... pET-His-GST-tev-LIC (Addgene #29655, Gradia Lab), pGEX-4T-3-mR7BD (Addgene #79149 ...
-
bioRxiv - Immunology 2021Quote: ... HEK293 and HEK/TLR4 cells were transiently transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786) to generate HEK/ACE2 or HEK/TLR4/ACE2 cell lines ...