Labshake search
Citations for Addgene :
1 - 50 of 1390 citations for LAG 3 Human HEK293 Fc since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were transfected with pFlagCMV2-14-3-3sigma (Addgene, Cambridge, MA, Plasmid #12453) (68) ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 (previously described20) were transduced with lentiviruses carrying dCAS9-10xGCN4 (Addgene 60903) termed HEK293-ACE2-SunTag ...
-
bioRxiv - Biophysics 2023Quote: ... 3C protease site cloned into a pcDNA3 vector containing human IgG Fc derived from pcDNA3-Nrxn1beta AS4(-)-Fc (a gift from Peter Scheiffele & Tito Serafini, Addgene plasmid # 59313 ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into a pcDNA3.1-Hygro(-)-like with a C-terminal HRV 3C cut site and human Fc tag amplified from Addgene plasmid 145164 using standard cloning techniques ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were transfected with pMIB1-FLAG (Addgene# 37116) and pHA-Ub (Addgene# 18712 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The GFP nanobody-Fc fusion construct (pGEMHE-vhhGFP4-hIgG1-Fc; Addgene #105576) was described previously (Clift et al. ...
-
bioRxiv - Neuroscience 2023Quote: ... the coding sequence of the extracellular region of human TfR1 (residues 89–760) were amplified by PCR and inserted into pCMV6-XL4 FLAG-NGRN-Fc (Addgene #115773) with EcoRV and XbaI sites ...
-
bioRxiv - Cell Biology 2022Quote: HEK293 cell were transfected with pGL3BRE Luciferase (#45126, Addgene®) and pCMV-Renilla luciferase plasmid (Thermofisher #16153) ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were electroporated with plasmid DNA pcDNA3.1/Zeo(+) (Addgene) containing only the Strep-Flag (SF)-tag (mock) ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293 cells transfected with either cmv-gfp (control; Addgene 11153) or cmv-CAPS-FLAG were plated in a 96-well plate ...
-
bioRxiv - Neuroscience 2022Quote: ... and IgG2a Fc (Addgene #114492), were amplified and extracted similarly ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293 cells were transfected with 3.0ug pcDNA3.1-hACE2 (Addgene, 145033, USA) plasmids by Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293 cells were transfected with PPRE-H2b-eGFP (59) (Addgene #84393) using Invitrogen Lipofectamine 3000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... of the parental cells (HEK293) with lentiCRISPR v2 plasmid57 (Addgene #52961) containing target specific gRNAs listed in Methods Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Immunology 2021Quote: ... HEK293 and HEK/TLR4 cells were transiently transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786) to generate HEK/ACE2 or HEK/TLR4/ACE2 cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg pBOB-EF1-FastFUCCI-Puro (86849 from Addgene, RRID:Addgene_86849) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg pBOB-EF1-FastFUCCI-Puro (86849 from Addgene, RRID:Addgene_86849) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Genomics 2019Quote: HEK293 cells were co-transfected with 400ng of pY117 (pcDNA3.1-huMb3Cpf1) (Cat. 92293, Addgene) and 100ng of crRNA PCR product using Lipofectamine 2000 (Cat ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR mediated knock-outs were performed by transducing HEK293 cells with LentiCRISPRV2 (Addgene #52961) lentivirus expressing sgRNAs targeting genes of interest (FASTKD5_sg1 ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Molecular Biology 2019Quote: Mouse SEMA6A-Fc and SEMA6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively) and human SEMA6A was gene-synthesized (GeneArt) ...
-
bioRxiv - Molecular Biology 2019Quote: ... Mouse Sema6a-Fc and Sema6c-Fc expression constructs were a gift from Woj Wojtowicz (Addgene plasmids 72163 and 72167, respectively). Plasmid pHis1522 encoding his-tagged TcsL was synthesized and codon optimized for Bacillus megaterium (Genscript) ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... United States).62,63 Plasmid constructs pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-sACE2-T92Q-Fc(IgG1) were obtained from Addgene (United States). The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Developmental Biology 2020Quote: ... HEK293/HEK293T cells stably transduced with the Wnt reporter Super TOP-Flash (STF, Addgene Plasmid #12456) were previously described (Bauer et al ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Cell Biology 2022Quote: ... new lentiviral particles were produced by transfecting HEK293 cells with 4µg Apple-53BP1trunc (69531 from Addgene, RRID:Addgene_69531) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... new lentiviral particles were produced by transfecting HEK293 cells with 4µg Apple-53BP1trunc (69531 from Addgene, RRID:Addgene_69531) + 4µg pMD2.G (12259 from Addgene ...