Labshake search
Citations for Addgene :
51 - 81 of 81 citations for L Leucine 13C6 99%;15N 99% Microbiolog Pyrogen Test since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... L-Myc or LacZ open reading frame (ORF) was cloned into pLEX_307 (a gift from David Root, Addgene #41392) using the Gateway® cloning methods according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 75 ng/µl of a construct expressing a sgRNA targeting ACGGCTCATAAGAGACTTGG (derived from p46169, which was a gift from John Calarco, Addgene plasmid # 46169 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats received bilateral intra-accumbens infusions (1 μl/side) of a Cre-dependent adeno-associated viral vector (AAV) expressing eYFP (AAV5-EF1a-DIO-eYFP-WPRE-hGH; Addgene) or a Cre-dependent AAV expressing ChR2 with an eYFP tag (AAV5-EF1a-DIO-hChR2(H134R)-eYFP-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... or in case of the aspC deletion the chloramphenicol (Cap) cassette from pKD3 (pKD3 was a gift from Barry L. Wanner (Addgene plasmid # 45604 ...
-
bioRxiv - Systems Biology 2022Quote: ... kanamycin resistance cassettes were generated via PCR – ‘KO’ primers with 50 bp homologous arms are listed in Supplementary Table S4 – using the kanamycin (Km) cassette from pKD4 (pKD4 was a gift from Barry L. Wanner (Addgene plasmid # 45605 ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.1 μL of adeno-associated virus serotype 9 (AAV9) carrying GCaMP6f under the excitatory neuronal promoter CaMKII (AAV-CaMKII-GCaMP6f) (Addgene) to co-transfect the TRPV1 and GCaMP6f into neurons.
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with 2.5ul PLUS reagent with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene 35431) and TALEN-R (Addgene 35432 ...
-
bioRxiv - Neuroscience 2023Quote: ... into the DMS (0.3 µl) and of an AAV encoding the cre-dependent genetically encoded calcium indicator GCaMP8s (AAV9-Syn-FLEX-GcAMP8s-GFP, Addgene) into either the CeA or BLA (0.1-0.2 µl) ...
-
bioRxiv - Cell Biology 2019Quote: ... The pDB070.iodo.5 plasmid containing the modified tRNA and tRNA synthetase for p-iodo-L-phenylalanine incorporation was obtained from Addgene (#99397) as a gift from David Liu [31] ...
-
bioRxiv - Biophysics 2021Quote: ... The mEGFP-(L)_pcDNA3.1+ plasmid was obtained by amplifying mEGFP from an mEGFP-N1 vector (a gift from Michael Davidson, Addgene plasmid # 54767) (using a primer encoding a long rigid linker sequence ...
-
bioRxiv - Synthetic Biology 2020Quote: ... The integration of the reporter was performed by co-transfecting 1000 ng TagRFP reporter (5xTetO-pEF-TagRFP-3xNLS) donor plasmid and 500 ng of each TALEN arm (AAVS1-TALEN-L (Addgene #35431) targeting TGTCCCCTCCACCCCACA and AAVS1-TALEN-R (Addgene #35432 ...
-
bioRxiv - Systems Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Biophysics 2022Quote: HEK 293T cells were co-transfected with either pmNG-Mpro-Nter-auto-NLuc or pmNG-Mpro-Nter-auto-L-NLuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (Addgene plasmid # 141370) or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A ...
-
bioRxiv - Biochemistry 2020Quote: ... without start codons and without their native signal peptides identified using SignalP 5.0 with the Gram-positive setting.35 Their open-reading frames were cloned into the expression vector p15TV-L (AddGene ID: 26093) under the T7 promoter and in-frame with the N-terminal 6xHisTag (Twist Bioscience) ...
-
bioRxiv - Biophysics 2021Quote: ... a mp-mEYFP-(L)-mCherry2-(L) construct was first cloned by amplifying mCherry2 from a mCherry2-C1 vector (a gift from Michael Davidson, Addgene plasmid # 54563) and inserting it into mp-mEYFP-(L)_pcDNA3.1+ by digestion with AflII and KpnI ...
-
bioRxiv - Biochemistry 2022Quote: ... The open-reading frames (codon-optimized for expression in E. coli) were cloned into the expression vector p15TV-L (AddGene ID: 26093) under the T7 promoter and in-frame with the N-terminal 6xHisTag (Twist Bioscience) ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μl of AAV5-Syn-GCaMP6f-WPRE-SV40 (titre 2.8 × 1013 GC/ml; gift from Douglas Kim & GENIE Project; Addgene viral preparation #100837-AAV5)62 was injected using a microinjection pump (Nanoliter 2010 ...
-
bioRxiv - Neuroscience 2021Quote: ... and SAD-B19 helper proteins (N, 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were stereotaxically injected under isoflurane anesthesia (1% v/v in oxygen, 1 L/min) with 250 nL of AAV8-hSyn-DIO-hM3d(Gq)-mCherry (Addgene, Catalog # 44361-AAV8) at a rate of 50 nL/min using a 1000 nL Hamilton syringe bilaterally in the dorsal striatum (coordinates ...
-
bioRxiv - Developmental Biology 2019Quote: ... Injection mixes with a total volume of 50 μl were prepared in milliQ H2O and contained a combination of 30-50 ng/μl Peft-3::cas9 (46168; Addgene; Friedland et al., 2013), 50-100 ng/μl Pu6::sgRNA with sequences targeted against pop-1 or rnt-1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Synaptophysin1-mCherry plasmid was generated by replacing the pHluorin-tag in Synaptophysin1-pHluorin (gift from L. Lagnado, Addgene plasmid # 24478, (Granseth et al, 2006)) with mCherry from pmCherry-N1 (Invitrogen) ...
-
bioRxiv - Bioengineering 2023Quote: ... was transfected with 1 µL AAV1-hSyn1-GCaMP6f-P2A-nls-dTomato virus (Addgene viral prep #51085-AAV1, http://n2t.net/addgene:51085, RRID:Addgene 51085, a gift from Jonathan Ting) diluted 1 ...
-
bioRxiv - Cell Biology 2023Quote: ... vectors encoding a pair of AAVS1-specific zinc finger nucleases (AAVS1-ZFN-L and AAVS1-ZFN-R) and an AAVS1 Neo-CAG-rtTA donor template were obtained from Addgene (plasmids #60915, #60916, and #60431). For transfection ...
-
Axon-secreted chemokine-like Orion is a signal for astrocyte infiltration during neuronal remodelingbioRxiv - Neuroscience 2020Quote: ... to recombine the inserts into the destination UAS vector pJFRC81-GW-2xMyc (L. G. F., unpublished) which was generated from pJFRC81-10XUAS-IVS-Syn21-GFP-p10 (Addgene plasmid 36462 deposited by G. Rubin43) by replacing the GFP ORF with a Gateway cassette adding on a C-terminal 2x Myc tag ...