Labshake search
Citations for Addgene :
601 - 650 of 678 citations for L Aspartic Acid N T Boc B Bz Ester 13C4 97 99%; 15N 97 99% since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... AAVS1-TALEN-L and AAVS1-TALEN-R were gifts from Danwei Huangfu (Addgene plasmid # 59025 and 59026) (González et al. ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Molecular Biology 2019Quote: ... GFP-POLE3 full length and GFP-POLE3 with amino acid residues 113-140 deleted (GFP-POLE3ΔC) were cloned between NheI and AgeI restriction sites of pCW57.1 (Addgene: 41393),
-
bioRxiv - Biochemistry 2021Quote: ... DNA encoding amino acids Ala696-Phe740 of human DDX1 was cloned into UC Berkeley MacroLab 438C (Addgene plasmid #55220). The resulting plasmid encoded for untagged RTCB(1-505) ...
-
bioRxiv - Cell Biology 2020Quote: The GeCKO V2 human library A and B containing 112417 sgRNAs targeting 19052 genes as well as 1000 nontargeting control sgRNAs was obtained from Addgene (Cat.# 1000000048 and 1000000049). Plasmid DNA was amplified and lentivirus was produced and amplified using HEK293FT cells following the provided protocol (51) ...
-
bioRxiv - Cell Biology 2023Quote: ... C-tRFP-Lck (cloned into PCMV6-AC-RFP expression vector) and TagRFP-T-EEA1 (cloned into pEGFP-C1 vector) were purchased from Addgene (respectively #RC100049 and #42635). Strawberry-βarr2 was a gift from Prof ...
-
bioRxiv - Neuroscience 2020Quote: ... Plasmids coding for pHRIG-Akt1 (Akt-CA) and pHRIG-AktDN (Akt-N) were gifts from Heng Zhao (Addgene plasmids #53583 and 53597 respectively). MAP2-GFP was previously described (Liot et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... with the only exception of ΔR2 and ΔF_ALL_Inv that were generated by using a pair of sgRNA. The guide sequences (listed in Supp. Table 1) were then cloned in px459 CRISPR/Cas9 vector (Addgene Cat. N. 62988), previously digested with Bbs1 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The original bicone construct (A2C-∆ N) was prepared by deleting gvpN from the full GV gene cluster (available on Addgene as plasmid #106473) via KLD mutagenesis using enzymes from New England Biolabs and primers from IDT ...
-
bioRxiv - Systems Biology 2023Quote: ... mCherry-LC3 and mNeon tagged N-terminally with the lipidation sequence of Lck (LckLip-mNeon, the original plasmid was a gift from Dorus Gadella (Addgene plasmid # 98821, (40)) ...
-
bioRxiv - Biophysics 2023Quote: ... and its variants were cloned into the pEG-BacMam expression vector with GFP and 8X-His tags at the N-terminus (Addgene, see Table S2). For FLAG-tagged KRAS expression constructs ...
-
bioRxiv - Bioengineering 2024Quote: ... pET28a-SUMO-SpyTag003 (N-terminal His6 tag-SUMO protein-SpyTag003) was cloned previously by Irsyad Khairil Anuar (University of Oxford) (GenBank and Addgene deposition in progress). pDEST14-SpyCatcher003-TEVs-SpyTag003DA (‘Masked SpyCatcher0003’ ...
-
bioRxiv - Bioengineering 2024Quote: ... pDEST14-SpyCatcher003-TEVs-SpyTag003DA (‘Masked SpyCatcher0003’; N-terminal His6 tag-SpyCatcher003-TEV protease cleavage site-SpyTag003 D117A, GenBank and Addgene deposition in progress) was derived from pDEST14-SpyCatcher003 (GenBank Accession no ...
-
bioRxiv - Microbiology 2020Quote: ... a total of 300 million Huh7.5.1-Cas9 cells were then separately transduced with the lentiviral gRNA sublibraries A and B of the human GeCKO v2 library (Addgene #1000000049, gift from Feng Zhang) at a multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2020Quote: ... of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572; http://n2t.net/addgene:26572; RRID:Addgene_26572). The mApple-myosin X was subcloned by the Protein Cloning and Expression Core facility of the MBI.
-
bioRxiv - Neuroscience 2021Quote: ... 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Microbiology 2019Quote: ... was a gift from L. Kane (de Souza, Oriss et al. 2005) and pLXSN-Axl (Addgene plasmid # 65222) a gift from A ...
-
bioRxiv - Systems Biology 2022Quote: ... cassette from pKD4 (pKD4 was a gift from Barry L. Wanner (Addgene plasmid # 45605; http://n2t.net/addgene:45605; RRID:Addgene_45605), (Datsenko & Wanner ...
-
bioRxiv - Systems Biology 2022Quote: ... cassette from pKD3 (pKD3 was a gift from Barry L. Wanner (Addgene plasmid # 45604; http://n2t.net/addgene:45604; RRID:Addgene_45604)) ...
-
bioRxiv - Neuroscience 2021Quote: ... mice were microinjected 0.3 µl of AAV5-hsyn-NE2.1 (h-N01, WZ Biosciences) and 0.5 µl of AAV9-hsyn-jRGECO1a (100854, Addgene) to the left Cg1 (AP=2.2mm ...
-
bioRxiv - Developmental Biology 2021Quote: The Tg(fli1a:Brainbow1.0L)mu254 (flibow) transgenic fish was generated by cloning the CMV-Brainbow-1.0 L construct (Addgene #18721) downstream of the fli1a promoter62 ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Microbiology 2021Quote: pLenti.GFP.NLuc is a dual GFP/nanoluciferase lentiviral vector based on pLenti.CMV.GFP.puro that contains a GFP/nanoluciferase cassette separated by a picornavirus P2A self-processing amino acid motif cloned into the BamH-I and Sal-I sites (Addgene plasmid #17448 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Biochemistry 2023Quote: The coding sequence for amino acids 1-110 of GCP2 were PCR amplified from pACEBac1-gamma-TuSC (a gift from Tarun Kapoor (Addgene plasmid # 178079 ...
-
bioRxiv - Biochemistry 2020Quote: ... and then the cDNA encoding FKBP_F36V was replaced by the cDNA encoding FKBP (obtained from the YFP-FKBP cDNA, the Addgene plasmid 20175 donated by T. Meyer40). Halo7-β2AR-FKBP expressed in L cells was fluorescently labelled by incubating the cells for 24 - 48 h with 5 nM Halo-tag conjugated with SaraFluor 650T (Goryo-Kayaku ...
-
bioRxiv - Molecular Biology 2023Quote: ... RBM41 C-terminal fragment (259–413) and full-length 65K were cloned into MAC-tag-N vector (Addgene #108078, a gift from Markku Varjosalo) using Gateway cloning as described (Liu et al. ...
-
bioRxiv - Microbiology 2022Quote: ... were introduced into a previously described spike-expression plasmid containing D614G and a 21-amino-acid deletion in the cytoplasmic tail (Addgene 158762) (34) ...
-
bioRxiv - Molecular Biology 2020Quote: ... the sequence encoding the native signal peptide and ECD of GPR56 (amino acids 1-400) was subcloned from pCAG-hGPR56-IRES-GFP (from Christopher A Walsh, Addgene 52297) into pCEP4 (Invitrogen ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... The catalytically active domains of JARID1A enzyme (1-797 amino acids) was amplified from pcDNA3/HA-FLAG-RBP2 plasmid (Addgene #14800), a gift from William Kaelin (Klose et al ...
-
bioRxiv - Biochemistry 2022Quote: ... corresponding to amino acids 629-633 of AR) of the eGFP-AR fusion protein73 was removed from peGFP-C1-AR (Addgene #28235) using the Q5 site-directed mutagenesis kit and primer design tools (New England BioLabs ...
-
bioRxiv - Biochemistry 2023Quote: ... The DNA fragment encoding TwCel5CAT was cloned (26 - 320 amino acid residues) into the pNIC-CH expression vector (AddGene, Cambridge, MA), which adds a C-terminal polyhistidine-tag (6xHis-tag ...
-
bioRxiv - Cell Biology 2023Quote: The EGFP-tr53BP1 construct was assembled using Gibson Assembly with a fragment of human 53BP1 (amino acids 1221-1709, Addgene #69531) (4 ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... L-Myc or LacZ open reading frame (ORF) was cloned into pLEX_307 (a gift from David Root, Addgene #41392) using the Gateway® cloning methods according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentivirus was produced from pLenti-SV40-T-tsA58 (abm cat# LV629) as previously described (51) using the VSV envelope from pMD2.G (Addgene cat#12259, gift from Didier Trono) and the packaging plasmid pCMV delta R8.2 (Addgene cat # 12263 ...
-
bioRxiv - Cell Biology 2024Quote: ... N-terminal FLAG-tagged CAPS was created by recombining the human CAPS gene (CAPS/pENTR; DNAsu HscD00514950) into pEZFLAG (Addgene#18700; Guo et al., 2008) using Gateway cloning ...
-
bioRxiv - Cell Biology 2020Quote: Human SH3 domain nucleotides (hLynSH3, amino acids 63-123) were amplified by PCR and cloned into a mammalian expression vector pEBG (Addgene, plasmid # 22227) with an N-terminal glutathione S-transferase (GST ...
-
bioRxiv - Bioengineering 2021Quote: HDM-SARS2-Spike-delta21 and HDM-SARS2-Spike-del21-614G encoding SARS-CoV-2 Spike with 21 amino acid C-terminal deletion for lentiviral pseudo-typing were purchased from Addgene (Watertown, MA) with serial numbers of Addgene #155130 and Addgene#158762 ...
-
bioRxiv - Cell Biology 2020Quote: ... PA28γ ORF WT or minus the C-terminal 14 amino acids (ΔC) were cloned into pSBbi-Pur (a gift from E. Addgene plasmid #60523) according to (Kowarz et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... A fragment containing three repetitions of the retinoic acid response element (RARE) sequence followed by the weak promoter SV40 was sub-cloned from pGL3-RARE-luciferase (Addgene Plasmid #13458), a kind gift of the Underhill Lab64 ...
-
bioRxiv - Molecular Biology 2024Quote: The HTLV-1 CA (Gag amino acids 132-349) was cloned into the 6×His SUMO bacterial expression plasmid (pHYRSF53, Addgene, Watertown, MA), with mutants created by using the Gibson assembly procedure ...
-
bioRxiv - Biochemistry 2024Quote: The plasmid encoding amino acids 1-393 of the p53 protein with a FLAG tag at the C-terminus (Addgene plasmid #10838) was used as a template for site-directed mutagenesis to delete the N-terminal regions spanning amino acids 1-31 ...
-
bioRxiv - Cell Biology 2020Quote: ... and 75 ng/µl of a construct expressing a sgRNA targeting ACGGCTCATAAGAGACTTGG (derived from p46169, which was a gift from John Calarco, Addgene plasmid # 46169 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats received bilateral intra-accumbens infusions (1 μl/side) of a Cre-dependent adeno-associated viral vector (AAV) expressing eYFP (AAV5-EF1a-DIO-eYFP-WPRE-hGH; Addgene) or a Cre-dependent AAV expressing ChR2 with an eYFP tag (AAV5-EF1a-DIO-hChR2(H134R)-eYFP-WPRE-hGH ...
-
bioRxiv - Systems Biology 2022Quote: ... or in case of the aspC deletion the chloramphenicol (Cap) cassette from pKD3 (pKD3 was a gift from Barry L. Wanner (Addgene plasmid # 45604 ...
-
bioRxiv - Systems Biology 2022Quote: ... kanamycin resistance cassettes were generated via PCR – ‘KO’ primers with 50 bp homologous arms are listed in Supplementary Table S4 – using the kanamycin (Km) cassette from pKD4 (pKD4 was a gift from Barry L. Wanner (Addgene plasmid # 45605 ...