Labshake search
Citations for Addgene :
451 - 500 of 2525 citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... and 13.8μg of Human CRISPR Knockout Pooled Library (GeCKO v2) (Addgene # 1000000049) part A or part B were combined with Lipofectamine 3000 (Thermo Fisher Scientific # L3000015 ...
-
bioRxiv - Cell Biology 2020Quote: ... A negative selection cassette with human thymidine kinase was retrieved from Addgene #21911 (41) ...
-
bioRxiv - Neuroscience 2021Quote: ... The human CD68 promoter32 was cloned into the lentiviral vector FG12 (Addgene) using XbaI and XhoI sites ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Biophysics 2022Quote: ... The His6-SUMO tag was subsequently cleaved with human SenP1 (Addgene #16356) 27 and separated on Ni2+-Histrap HP column ...
-
bioRxiv - Biochemistry 2022Quote: ... The full-length human PIK3R5 (p101) gene was purchased from Addgene (70464), and the full-length human PIK3R6 (p84 ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Biochemistry 2022Quote: ... Human TXNRD1 sequence was cloned from a cDNA provided by Addgene (#38863), and TXNRD2 was synthesized as a gBlock gene fragment by IDT ...
-
bioRxiv - Cell Biology 2023Quote: ... tagBFP-Rab35 (Human Rab35; in lentivirus vector pLVX-M-puro (Addgene 125839)) ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Biochemistry 2023Quote: ... Human codon optimized wild-type Mpro was obtained from Addgene (catalog #141370). Mpro single point mutants (M49A ...
-
bioRxiv - Biochemistry 2023Quote: GST-tag human HP1⍺ was a kind gift from Naoko Tanese (Addgene plasmid # 24074 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The human TBXT sgRNA (CAGAGCGCGAACTGCGCGTG) was a gift from Jacob Hanna (Addgene plasmid #59726 ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2024Quote: The human CRISPR Brunello lentiviral pooled library (Addgene # 73178-LV)14 and human CRISPR Dolcetto (Set A) inhibition library (Addgene # 92386-LV)15 were used to identify genes responsible for enhanced survival of PANC-1 cells treated with nab-paclitaxel ...
-
bioRxiv - Biochemistry 2023Quote: ... Ttyh1 was expressed from a pLX304 vector after addition of C-terminal Strep and His tags to an existing construct (Addgene #161676, a gift from Mike McManus). To stably express fluorescently tagged Prom1 WT and W795R variants in HeLa cells for live cell imaging ...
-
bioRxiv - Cell Biology 2024Quote: ... a gift from Zuoshang Xu)63 and cloned in frame with the N-terminal 6- His-SUMO-TEV-site into the SspI site of pET 6His-SUMO-TEV LIC (1S) (Addgene 29659, a gift from Scott Gradia) using the HiFi Assembly kit (NEB) ...
-
bioRxiv - Molecular Biology 2021Quote: A codon adapted version of human DUX4 (pCW57.1-DUX4-CA, Addgene plasmid #99281) was cloned into an inducible ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human CTNNB1 expression plasmid deposited by Eric Fearon was purchased from Addgene (#16828). CD24 cDNA cloned into the pCDNA3.1 vector and the full-length 3′-UTR of CD24 cloned into pMIR (Ambion ...
-
bioRxiv - Cell Biology 2020Quote: pEGFP-LC3 (human) deposited by Toren Finkel lab was obtained from Addgene (# 24920)(Lee ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human MRTFA was amplified out of the p3xFLAG-MRTFA vector (Addgene plasmid#11978) and tagged with gateway adapters which preserve the N-terminal 3x FLAG tag from the vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... were generated by subcloning the respective human cDNA (from Addgene #100142 and #66350) into the MluI and BamHI sites] of the pLVX-Che-hi3 vector (a gift of Sanford Simon)78 ...
-
bioRxiv - Cell Biology 2021Quote: ... The coding sequences of human myogenin (gift from Matthew Alexander & Louis Kunkel (Addgene plasmid #78341 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... WT and inactive human TRPA1 variants were subcloned into CaM/pIRES2-eGFP (Addgene) at the NheI/EcoRI sites to generate a positive fluorescent readout for transfection in singly transfected calcium imaging studies ...
-
bioRxiv - Cancer Biology 2020Quote: ... Overlapping oligonucleotides (Feng Zhang lab human GeCKOv2 CRISPR knockout pooled library; Addgene #1000000048) were annealed to generate sgRNA targeting GFAT1 or NAGK ...
-
bioRxiv - Neuroscience 2022Quote: ... The V5-tagged human GLUT1 construct was a gift from Wolf Frommer (Addgene) 89 ...
-
bioRxiv - Cancer Biology 2022Quote: ... The designed sgRNAs were cloned into human lentiCRISPR v2 vector (Addgene, MA, USA). For lentiviral packaging ...
-
bioRxiv - Biophysics 2019Quote: ... CTD of the largest subunit of human RNA polymerase II (RPB1, Addgene 35175) and EGFP (Addgene 122147 ...
-
bioRxiv - Biochemistry 2020Quote: We used the human SREBP-1c cDNA containing vector pQCXIN (Addgene, USA, 631514) as a template to generate 2x Flag tagged ...
-
bioRxiv - Cancer Biology 2020Quote: The cDNA of human SNAI1 was subcloned from Flag-Snail WT (Addgene 16218) into pWZL-Blast-GFP (Addgene 12269 ...
-
bioRxiv - Immunology 2020Quote: ... a vector containing human IgG3 was purchased from Addgene (pVITRO1-102.1F10-IgG3/λ) and then cloned into a vector for recombinant IgG expression that we previously engineered [59].
-
bioRxiv - Cancer Biology 2020Quote: ... FLAG-tagged human EZHIP was cloned into the pMT-puro vector (Addgene #17923). Transfections were performed with 2 μg plasmid DNA ...
-
bioRxiv - Developmental Biology 2020Quote: ... human MEG3 cDNA was PCR amplified from the pCI-Meg3 (Addgene Plasmid #44727) using NEB Q5 high-fidelity polymerase ...
-
bioRxiv - Cell Biology 2022Quote: ... human KIFC1(125-673) and mouse BICD2(15-595) were obtained from Addgene (plasmids #133242 ...
-
bioRxiv - Bioengineering 2022Quote: ... we utilized the Human Genome-wide CRISPRa-v2 Library (Addgene Pooled Libraries #83978) consisting of 104,540 sgRNAs targeting 18,915 genes (top 5 sgRNAs per gene) ...
-
bioRxiv - Cell Biology 2022Quote: Point mutations were generated on a human fibronectin pMAX vector plasmid (Addgene, #120402) using the Q5 site-directed mutagenesis kit (BioLabs ...
-
bioRxiv - Neuroscience 2022Quote: Human ATG9A was amplified from pMXs-puro-RFP-ATG9A from Addgene (plasmid #60609) and subcloned into the EGFP-N1 vector ...
-
bioRxiv - Molecular Biology 2022Quote: ... Brunello library targeting all human protein-coding genes28 was purchased from Addgene (#73179). Quality of the MYC-CRISPR and Brunello libraries was verified by next-generation sequencing on Illumina platform (BGI ...
-
bioRxiv - Cell Biology 2023Quote: ... Human MCU-GFP plasmid was a gift from Vamsi Mootha (Addgene plasmid # 31732).
-
bioRxiv - Neuroscience 2023Quote: ... The human KIBRA sequence originated from the pBabepuro-KIBRA vector (80) (Addgene #40887). For lentiviral-based expression ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Cell Biology 2023Quote: A vector expressing HA-tagged human E6AP was obtained from Addgene (Plasmid #8658), E6AP mutants were generated using site-directed mutagenesis (Agilent ...
-
bioRxiv - Neuroscience 2023Quote: ... The human CRISPR Knockout library was a gift from Michael Bassik (Addgene #101927). In brief ...
-
bioRxiv - Bioengineering 2023Quote: ... a plasmid containing the human codon-optimized Cas12a gene was obtained from Addgene, then was PCR amplified using Q5 Hot Start high fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cancer Biology 2023Quote: ... All the sgRNAs targeting human genes were cloned into lentiCRISPR v2 (Addgene, #52961), lentiCas9-Blast (Addgene ...