Labshake search
Citations for Addgene :
101 - 150 of 976 citations for Junctional adhesion molecule B JAM B Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... ΔPPXY)-T2A-GFP were generated by PCR from pCDNA4/TO-HA-NLS-SV40-B-MYB (this work) and pSpCas9n(BB)-2A-GFP (PX461) (Addgene #48140). All entry vectors were subcloned into pENTR3C (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Immunology 2020Quote: ... Selected gRNAs shown in Figure 1 B and C were synthesized by IDT and cloned into eSpCas9(1.1) (a gift from Feng Zhang Addgene plasmid # 71814). The LC donor DNA of HuGL18 was designed as follows from 5′ to 3′ ...
-
bioRxiv - Cancer Biology 2023Quote: A double cutting CRISPR/Cas9 approach with a pair of sgRNAs (sgRNA A and B) was used to completely excise exon 2 (322 bp region) of DYRK1A using a px458 vector (Addgene #48138) that was modified to express the full CMV promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human DLK1 ectodomain expression vector was obtained from Addgene (DLK1-bio-His, RRID:Addgene_51876) (Sun et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... pEZYmyc-HIS (Addgene, #18701) or pDEST-myc ...
-
bioRxiv - Cancer Biology 2022Quote: ... ITGA2-HIS (Addgene, #51910), ITGB2-YFP (Addgene ...
-
bioRxiv - Neuroscience 2024Quote: ... his-hOPTN (Addgene, #23053), mOPTN (mouse tissue cDNA) ...
-
bioRxiv - Cell Biology 2024Quote: ... Eps15-GFP-His (Addgene #170860 ...
-
bioRxiv - Immunology 2021Quote: ... The human full length (HFL) gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537 ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Microbiology 2023Quote: ... resistance flanked by the 5’ region of VDU and part of the VDU coding sequence was prepared by PCR using the plasmid pTREX-b-NLS-hSpCas9 (a gift from Rick Tarleton, Addgene plasmid #62543) as template and the donor TcVDU84BlastFOW and donor TcVDU84BlastREV ...
-
bioRxiv - Genetics 2023Quote: A phenotypically WT (ROSA+/cre CTIPc/c Bcl2+) v-abl immortalized B cell line was infected with lentivirus for doxycycline-inducible SpCas9 (Addgene Plasmid #50661). Single clones were generated and screened for high SpCas9 inducibility after doxycycline treatment (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and 0.34 μg of viral entry protein (SARS-CoV-2 Spike, BEI #NR-53742) or pCMV-VSVG (a gift from B. Weinberg, Addgene plasmid #8454) using 8 μl of TransIT-293 (Mirus Bio #MIR 2705 ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Cell Biology 2024Quote: ... Specific gRNAs against mouse Cyri-b (ex3: CACCGGGTGCAGTCGTGCCACTAGT) were cloned into the sPs-U6-gRNA-Cas9 (BB)-2A-GFP vector (Addgene Plasmid #48138) (Ran et al. ...
-
bioRxiv - Cancer Biology 2023Quote: ... from the expression vector pcDNA3.1/Myc-His(-)-HSulf-2 bearing human Sulf-2 cDNA (a gift from Steven Rosen, Addgene plasmid # 13004) (Morimoto-Tomita et al. ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were transfected with pMIB1-FLAG (Addgene# 37116) and pHA-Ub (Addgene# 18712 ...
-
bioRxiv - Systems Biology 2021Quote: ... The pMEL16 (His-, Addgene 107922) and p414-TEF1p-Cas9-CYC1t (hereafter referred to as P414 ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID ...
-
bioRxiv - Bioengineering 2023Quote: HIS-tagged HER2 (Addgene #16257) was expressed using the Expi293™ expression system (Thermo Fisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2020) were deleted of their hygromycin B resistance gene via Lipofectamine transfection of a plasmid expressing FlpE (Addgene #20733; (Beard et al. 2006)) ...
-
bioRxiv - Neuroscience 2019Quote: ... or AAV5-hDlx-GqDREADD-dTomato (3.15×10^15 virus molecules/mL) (Addgene plasmid # 83897 ...
-
bioRxiv - Cell Biology 2022Quote: HEK293 cell were transfected with pGL3BRE Luciferase (#45126, Addgene®) and pCMV-Renilla luciferase plasmid (Thermofisher #16153) ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293 cells were electroporated with plasmid DNA pcDNA3.1/Zeo(+) (Addgene) containing only the Strep-Flag (SF)-tag (mock) ...
-
bioRxiv - Cell Biology 2024Quote: ... HEK293 cells transfected with either cmv-gfp (control; Addgene 11153) or cmv-CAPS-FLAG were plated in a 96-well plate ...
-
bioRxiv - Cell Biology 2020Quote: The GeCKO V2 human library A and B containing 112417 sgRNAs targeting 19052 genes as well as 1000 nontargeting control sgRNAs was obtained from Addgene (Cat.# 1000000048 and 1000000049). Plasmid DNA was amplified and lentivirus was produced and amplified using HEK293FT cells following the provided protocol (51) ...
-
bioRxiv - Cancer Biology 2020Quote: ... pcDNA3.1-Flag-His-ATM (Addgene 31985), pcDNA3.1-mCherry-NLRP3 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and SERPINE1-bio-his (Addgene #52077) which were gifts from Gavin Wright without signal sequence to prevent cleavage of fused proteins (75) ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139113)
-
bioRxiv - Developmental Biology 2021Quote: pET-28b-RfxCas13d-His (Addgene #141322) plasmid containing the T7 promoter was linearized by using NotI restriction site ...
-
bioRxiv - Developmental Biology 2023Quote: ... pcDNA3.0-BMAL1-His (AddGene CN: 31367), pcDNA3.0-3XFLAG-Cry2 plasmids and PEI max 40k (Polysciences Inc CN ...
-
bioRxiv - Developmental Biology 2023Quote: pcDNA3-BMAL1-His (AddGene CN: 31367) were purchased from the Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293 cells were transfected with 3.0ug pcDNA3.1-hACE2 (Addgene, 145033, USA) plasmids by Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Cancer Biology 2020Quote: HEK293 cells were transfected with PPRE-H2b-eGFP (59) (Addgene #84393) using Invitrogen Lipofectamine 3000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... of the parental cells (HEK293) with lentiCRISPR v2 plasmid57 (Addgene #52961) containing target specific gRNAs listed in Methods Table 1 ...
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Cell Biology 2020Quote: 6×His-tagged VHH-mCherry (Addgene #109421) was transformed into BL21DE3 E.coli cells ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139112)
-
bioRxiv - Cell Biology 2020Quote: ... and 6x-HIS-tagged-HOXB2 (Addgene 8522) were obtained from commercial vendors and cloned into pCMV6 vector and transfected into HEK cells ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139116)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139117)
-
bioRxiv - Molecular Biology 2019Quote: ... MmEsco2-myc/his and H2B-mCherry were amplified from the vectors pcDNA3.1/myc-His and pcDNA3-H2B-mCherry (Addgene, 20972), respectively ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The CyPet gene was amplified by PCR from the pCyPet-His vector (pCyPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14030 ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The YPet gene was amplified by PCR from the pYPet-His vector (pYPet-His was a gift from Patrick Daugherty; Addgene plasmid # 14031 ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139124, 139125 respectively)
-
bioRxiv - Biochemistry 2021Quote: ... pFastBac1 His-MBP (#30116) were procured from Addgene. pNIC28-MBP was constructed by replacement of TrxT with MBP [22] ...
-
bioRxiv - Bioengineering 2022Quote: ... the plasmid pET-28b-Cas9-His (Addgene #47327) was transformed into Rosetta (DE3 ...