Labshake search
Citations for Addgene :
451 - 500 of 964 citations for Iron Sulfur Cluster Co Chaperone Protein HscB Mitochondrial HSCB Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: HEK293T-LentiX cells were co-transfected for 12 h with 10 µg psPAX2 (kind gift from Didier Trono, Addgene #12260), 2.5 µg pMD2.G (kind gift from Didier Trono ...
-
bioRxiv - Genomics 2023Quote: ... then co-electroporated with pXR002: EF1a-dCasRx-2A-EGFP (pXR002: EF1a-dCasRx-2A-EGFP was a gift from Patrick Hsu (Addgene plasmid # 109050 ...
-
bioRxiv - Cell Biology 2023Quote: ... recombinant DNA constructs cloned in lentiviral plasmids described above were co-transfected with packaging and envelope plasmids psPAX2 (gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were co-transfected with two gRNAs and pSpCas9n(BB)-2A-Puro (PX462) V2.0 (Addgene, 62987 (Ran et al., 2013)) ...
-
bioRxiv - Biophysics 2023Quote: Fusion constructs with pTREtight2 vectors were co-transfected with reverse tetracycline-controlled transactivator 3 (pLenti CMV rtTA3 Hygro (w785-1)) plasmid (Addgene) in the presence of doxycycline (Clontech) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were seeded per well of a 6-well plate and co-transfected with 2.8 µg pHAGE-mKeima-LGALS3 (Addgene; 175780), 2.3 µg pPAX2 (Addgene ...
-
bioRxiv - Developmental Biology 2023Quote: Transgenic animals were generated by injecting transgenes (15 ng μl-1 each) mixed with a co-injection marker pRF-4 (120 ng μl-1) (Addgene) expressing a dominant negative variant of the rol-6 gene and an empty vector pSK (up to 200 ng μl-1 of DNA ...
-
bioRxiv - Immunology 2023Quote: Retrovirus were packaged by co-transfection of Phoenix-Eco cells with indicated plasmid and helper plasmid pCL-Eco (Addgene #12371) using calcium phosphate precipitate mediated transfection ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... HEK293T cells were co-transfected with pLenti-CRISPRv2 plasmids and the packaging plasmids pPAX2 (Addgene #12260, deposited by Didier Trono) and pMD2.G (Addgene #12559 ...
-
bioRxiv - Cell Biology 2024Quote: ... These two plasmids were co-electroporated with a plasmid encoding the sgRNA for the gene locus (Supplementary Table 2, Addgene #47108 ...
-
bioRxiv - Neuroscience 2024Quote: ... the ReaChR virus was co-injected unilaterally into the LC with AAV9-hSyn-FLEX-jGCaMP8m (3 × 1013 gc/mL, 162378-AAV9 from Addgene) or with AAV9-hSyn-GRABNEm (2-9 × 1013 gc/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were co-transfected with a single gRNA and pCAS9-mCherry empty (Addgene, 80975 (Schmid-Burgk et al., 2016)) using TransIT-2020 (Mirus ...
-
bioRxiv - Cell Biology 2024Quote: Cells were seeded in 10 mm plates at 60% of confluence in complete medium and then co-transfected with MPAct mCherry and YFP-CaaX vectors (selected plasmid constructs, corresponding sequence information is available on Addgene) 35 ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were co-transfected with a mixture of pSpCas9(BB)-2A-GFP plasmids (gift from Feng Zhang; Addgene plasmid #48138) containing two different sgRNA sequences (TTGGATGACTCGGACTCGCT and CGCTTGGTGATTCCATGTAA ...
-
bioRxiv - Genomics 2024Quote: ... Lentivirus was produced in HEK293T cells co-expressing the shRNA plasmid together with psPAX2 packaging plasmid and pVSV-G envelope plasmid (Addgene). Virus was concentrated using Lenti-X Concentrator (Takara ...
-
Hippocampal efferents to retrosplenial cortex and lateral septum are required for memory acquisitionbioRxiv - Neuroscience 2020Quote: ... enhanced yellow fluorescent protein (eYFP) or enhanced green fluorescent protein (eGFP): AAV1.CaMKIIa.eNpHR3.0.eYFP.WPRE.hGH (Addgene, #26971), AAV1.CaMKII.eYFP ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Genomics 2019Quote: ... we cloned effector proteins (PguCas13b: Addgene 103861 ...
-
bioRxiv - Genetics 2019Quote: ... Cas9 protein and mRNA (44758; Addgene) were co-microinjected into zygotes [F1 hybrids between strains FVB/NJ and B6(Cg)-Tyrc-2J/J] using the reagent concentrations listed in Table S1 ...
-
bioRxiv - Bioengineering 2021Quote: ... the Spike protein (Addgene plasmid # 145032) was cloned downstream of the TRE3G promoter ...
-
bioRxiv - Immunology 2021Quote: ... Lentiviruses were produced into HEK293T cells by using the calcium phosphate co-transfection method for each specific subcloned lentiviral pLKO.3G vector with the packaging plasmids gag/pol (Addgene #14887) and VSV-G (Addgene #14888) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Transformants were obtained by co-injecting (performed by the Genetics Fly Facility, University of Cambridge) this plasmid with a pCFD3-dU6:3gRNA plasmid (Addgene #49410) expressing the gRNA CTGTGATAGCCCAACTGTGA and screening for 3xPax3-dsRED ...
-
bioRxiv - Molecular Biology 2021Quote: ... Two pCFD4d plasmids (each at 40ng/µl) expressing four different sgRNAs were co-injected with 100ng/µl Hsp70-Cas9 (Addgene 45945) (Gratz et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... All cell lines used to assess mitotic progression (Figures 5 and S7) were generated by co-transfecting pcDNA3 encoding mCherry-tagged Histone H2B (Addgene: 20972) and pcDNA3 encoding GFP-tagged Lamin B1 (a kind gift from David Vaux) ...
-
bioRxiv - Cell Biology 2022Quote: Lentivirus particles were generated from HEK293T cells (ATCC CRL-3216) by co-transfection of lentiviral vectors with the packaging plasmid psPAX2 (Addgene #12260) and envelope plasmid pMD2G (Addgene #12259 ...
-
bioRxiv - Molecular Biology 2019Quote: ... N-terminal 3xFLAG_V5_GFP-tagging of endogenous nxf2 and panoramix loci was done by co-injecting a repair template and the gRNA containing plasmid (Addgene 45956) into act-Cas9 flies (BL-58492) ...
-
bioRxiv - Immunology 2019Quote: ... or VPR WT or a Q65R VPR mutant were produced through co-transfection of 293T cells with 4 plasmids coding for Gag/Pol (Addgene #12251), Rev (Addgene #12253) ...
-
bioRxiv - Cancer Biology 2019Quote: Viral particles were produced in 293T cells by co-transfecting plasmids of interest along with a lentivirus packaging plasmid (psPAX2, Addgene #12260) and a VSV envelope expression plasmid (pMD2.G ...
-
bioRxiv - Molecular Biology 2019Quote: ... Injection mix consisted of 0.5pmol/ul in vitro transcribed RNA and 2.5ng/ul co-injection marker (pmyo-2::mCherry::unc-54 3’UTR) plasmid pCFJ90 (Addgene, plasmid #19327), dissolved in water ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses made from pLentiCRISPRv.2 were produced by co-transfection of the lentiviral backbone constructs and packaging plasmids pSPAX2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Microbiology 2021Quote: VSV-G–pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Cell Biology 2021Quote: Viral particles for the generation of stable overexpressed cell lines were produced by co-transfection of pLEX_307 (a gift from David Root, Addgene plasmid # 41392) containing the target gene ...
-
bioRxiv - Microbiology 2020Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus expressing the full length Phf15 cDNA or empty vector control were co-transfected with pCL-10 A1 (Addgene plasmid #15805)[30] in HEK293T cells using Lipofectamine 3000 (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses made from pLentiCRISPRv.2 were produced by co-transfection of the lentiviral backbone constructs and packaging plasmids pSPAX2 (Addgene 12260) and pMD2.G (Addgene 12259) ...
-
bioRxiv - Biophysics 2020Quote: ... A homozygous clone that passed all QC (U2OS HP1⍺ 4) was co-transfected with the transposon vector pEF1a-OsTIR-IRES-NEO-pA-T2BH (Addgene 127910) and SB100X in pCAG globin pA (Addgene 127909) ...
-
bioRxiv - Neuroscience 2022Quote: Both Cas13/CAGEX and Cas13d/NT constructs were co-transfected with psPAX2 (packaging plasmid) (gift from Didier Trono, Addgene plasmid #12260) and VSV-G (viral envelope ...
-
bioRxiv - Pathology 2022Quote: ... Mouse stem cell virus (MSCV)-based retroviruses encoding either mCherry alone (#52114; MSCV-mCherry) or co-express MycN and mCherry (#73571; MSCV-MycN-mCherry) were purchased from Addgene (64). Ten μg of retroviral constructs (pMSCV-MycN-mCherry ...
-
Pathogenic variants of sphingomyelin synthase SMS2 disrupt lipid landscapes in the secretory pathwaybioRxiv - Cell Biology 2022Quote: ... low passage HEK293T cells were co-transfected with the corresponding pInducer20-FLAG-SMS2 construct and the packaging vectors psPAX2 (Addgene, 12260) and pMD2.G (Addgene ...
-
bioRxiv - Microbiology 2021Quote: ... the mutant constructs were co-transfected with psPAX2 and also the VSVg plasmid pMD2.G (Addgene; courtesy of Dr Didier Trono) at a molar ratio of 2:1:1 to increase the infection rate ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviruses were made by Lipofectamine 2000-based co-transfection of 293FT cells with the respective lentiviral expression vectors and the packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Systems Biology 2022Quote: Lenti vectors harboring the CRISPR/Cas9 system for Arhgdia targeting were produced by co-transfection of 293FT cells with psPAX2 (Addgene, #12260), pMD2.G (Addgene ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Repair templates were co-transformed into haploid ancestral strains with a plasmid encoding Cas9 and gRNAs targeting near the mutation site (Addgene #83476) (Laughery et al. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... We co-transformed a high-copy plasmid that contains the Cas9 gene and the guide RNA expression cassette (pML104; Addgene #67638) (Laughery et al ...
-
bioRxiv - Cell Biology 2022Quote: ... homology recombination cassettes containing the desired knock-in DNA with flanking regions of homology of 1075 bp to the target locus were co-transfected with a version of pSpCAS9(BB) (Addgene, 48139) containing the guide RNA sequence 5’-TCTTTGATGCTAGTTAAAGT-3’ and modified to removed puromycin resistance ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 S / HIV-1 pseudotyped viruses were packaged by co-transfecting a lentiviral construct pHIV-Luciferase (Addgene plasmid # 21375), a packaging construct psPAX2 (Addgene plasmid # 12260 ...
-
bioRxiv - Microbiology 2021Quote: ... pseudotyped lentiviruses expressing ACE2 orthologs tagged with FLAG at the C-terminus were produced by transient co-transfection of the third-generation packaging plasmids pMD2G (Addgene #12259) and psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2020Quote: Viral particles for the generation of stable overexpressed cell lines were produced by co-transfection of pLEX_307 (a gift from David Root, Addgene plasmid # 41392) containing the target gene ...