Labshake search
Citations for Addgene :
1 - 50 of 800 citations for IL 9 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Neuroscience 2023Quote: ... pCAG_MMP-9 – full length mouse (MMP-9) from pcDNA3.1_MMP-9-HA (Addgene #121172) cloned into pCAG vector ...
-
bioRxiv - Neuroscience 2020Quote: ... doxycycline-inducible pT-BclXL-miR-9/9*-124 (Addgene, 60857) and reverse tetracycline-controlled transactivator rtTA (Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2/9 encoding jRGECO1a under control of the human synapsin promoter (4 × 1013 gc/ml; customized from AddGene plasmid #61563 ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV2/9 (Addgene #112865), or rAAV2-retro (Addgene #81070 ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV2/1.ef1a.fDIO.GCaMP6s (Janelia Vector Core) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV2/9.syn.GCaMP7f (Addgene), AAV1.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/9 (Addgene #112865), or pUCmini-iCAP-PHP.eB (Addgene #103005) ...
-
bioRxiv - Neuroscience 2024Quote: ... pAAV2/9 (Addgene #112865), pAAV-hSyn-Cre (Addgene #170367)61 ...
-
bioRxiv - Neuroscience 2022Quote: ... pAAV2/9 Helper (Addgene, #112867), and pAd-deltaF6 (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... psPAX2 (Addgene 12260, 9 µg), the guide containing vector (pXPR_066 ...
-
bioRxiv - Developmental Biology 2023Quote: ... 9 µg psPAX2 (Addgene #12260), and 12 µg pLKO.1 transfer vector using Lipofectamine 2000 (Cat ...
-
bioRxiv - Cancer Biology 2020Quote: ... 9 μg pMD2.G (Addgene #12259) and 3 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Physiology 2023Quote: ... and 9 μg of psPAX2 (Addgene), 6 μg of psPAX2 (Addgene) ...
-
bioRxiv - Neuroscience 2023Quote: ... with GFP1-9::iRFP702 (Addgene #130125), mouseStoml3-GFP10::mCHERRY and mouseElkin1-GFP11::eBP2 plasmids using Fugene HD and following manufacturer’s instructions (Promega) ...
-
bioRxiv - Neuroscience 2021Quote: ... Four rats were injected into the right FC with 0.02 μL of AAV2/9-CaMKII-hChR2(E123A)-mCherry-WPRE.hGH (Catalog #AV-9-35506; Addgene plasmid #35506 ...
-
bioRxiv - Genetics 2022Quote: ... 9 µg psPax2 packaging plasmid (Addgene #12260), and 1 µg VSV-G envelope plasmid (Addgene #8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-GfaABC1D-GCaMP6f virus (Addgene #52925) was stereotaxically injected into the cortex 2 weeks before imaging ...
-
bioRxiv - Biochemistry 2023Quote: ... CryC was constructed by inserting PCR amplified spTC (Addgene plasmid #153003, (Cho et al., 2020a)) onto restriction-digested Cry2-mCherry (Addgene plasmid # 26871 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2/9-FLEX-tdTomato (Addgene, #28306-AAV9). For chronic window implantation ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 9 μg of psPAX2 packaging vectors (Addgene #12260) using polyethylenimine (Polysciences ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-Syn-DIO-EGFP (Addgene # 100043-AAV9). Assignment of AAV was counterbalanced for sex ...
-
bioRxiv - Neuroscience 2024Quote: ... serotype 9 (AAV9) expressing GCaMP6s (AAV9.CAG.GCaMP6s.WPRE.SV40, Addgene, USA) was injected subcutaneously in the nape of the neck of pups (P2-P6) ...
-
bioRxiv - Microbiology 2020Quote: ... 9 µg of psPAX2 (a gift from Didier Trono (Addgene plasmid # 12260 ...
-
bioRxiv - Microbiology 2019Quote: ... The sgRNA cassette from pgRNA-bacteria 9 (Addgene plasmid # 44251) was introduced into pSCrhaB2 by restriction cloning with EcoRI and HindIII (NEB ...
-
bioRxiv - Neuroscience 2022Quote: We obtained the AAV serotype 9 hSyn-Cre from Addgene (#105555 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.9.Ef1A.fDIO.EYFP (control for optogenetics, 140 nl, Addgene, no55641), ssAAV.1.2.hSyn1.dFRT.hM4D(Gi).mCherry(rev).dFRT.WPRE.hGHp(A ...
-
bioRxiv - Biochemistry 2023Quote: ... at AgeI and NheI sites and fusing PCR amplified CIB1 and spTN (Addgene plasmid # 153002, (Cho et al., 2020a)) using Gibson assembly ...
-
bioRxiv - Neuroscience 2020Quote: Brainbow3.0 AAV-2/9 and AAV-PhP.EB were obtained from Addgene and University of Michigan vector core ...
-
bioRxiv - Neuroscience 2021Quote: The adenoassociated virus (AAV) pAAV2/9.CAG.FLEX.GCaMP6s.WPRE.SV40 was purchased from Addgene (Addgene viral prep #100842-AAV9 ...
-
bioRxiv - Molecular Biology 2019Quote: ... thermophilus LMD-9 generated in this study are available from Addgene. Protein and DNA sequences for all St1Cas9 ORFs are available as supplemental items (Excel file) ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-FilaminA-N-9 (Addgene #55047, gift from Michael Davidson), pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene, 83896) at a concentration of 6+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV.9.FLEX.rev.ChR2(H134R).mCherry (optogenetics, 140 nl, Addgene, no. 18916), AAV.9.Ef1A.fDIO.EYFP (control for optogenetics ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Cell Biology 2022Quote: ... Stable CHO cell lines expressing CRT-GFP or CRT(Y108F)-GFP were obtained by co-transfection with pBABE-puro (Addgene) and selection with puromycin.
-
bioRxiv - Cancer Biology 2022Quote: ... and hAHRΔe8-9 sequences were cloned in a lentiviral plasmid (Addgene #52961) and subsequently to pcDNA3.1 vector with the In-fusion HD Eco-dry cloning (Takarabio) ...
-
bioRxiv - Cell Biology 2021Quote: ... We used TALENs targeting exon 9 of RBM20 (Addgene #108342 and #108343) to generate the RBM20 R636S Het iPSC line ...
-
bioRxiv - Microbiology 2022Quote: ... PCDNA3-GFP1-9 T2A mCherry was a gift from Xiaokun Shu (Addgene plasmid # 124430;http://n2t.net/addgene:124430 ...
-
bioRxiv - Neuroscience 2023Quote: ... we used AAV2/9-pAAV-hDlx-hM3Dq-dTomato-Fishell-4 (Addgene, 83897) and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV-Ef1a-DIO eNpHR3.0-EYFP (serotype 9) were purchased from Addgene. The plasmids of AAV[shRNA]-CMV>mCherry-U6>Scramble_shRNA (serotype 9) ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Bioengineering 2022Quote: The AAV2/9-CAG-DIO-ChrimsonR-tdTomato (Plasmid #130909) vector7 is from Addgene. The AAV2/9-EF1a-DIO-stGtACR2-EGFP-Kv2.1 plasmid is synthesized and constructed according to the original reports8 ...
-
bioRxiv - Genomics 2022Quote: ... Co-transfect 12 μg lentivector with packaging plasmids 9 μg psPAX2 (Addgene, #12260) and 3 μg pMD2.G (Addgene ...
-
bioRxiv - Developmental Biology 2021Quote: ... NM_007553.2) and subsequently subcloned into pENN.AAV.cTNT.PI.eGFP.WPRE serotype 9 adenoviral vector (Addgene, Cat.: #105543). A modified protocol from Wakimoto et al ...
-
bioRxiv - Developmental Biology 2021Quote: ... trans-plasmid encoding AAV replicase and capsid gene pAAV2/9 (Addgene, Cat.:112865) and either pAAV-cTnT-GFP (vehicle ...
-
bioRxiv - Developmental Biology 2021Quote: DR274 gRNA plasmids and Cas 9 protein were from Addgene (Cambridge Massachussets, USA) and New England Biolabs (Ipswich ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/9-EF1a-DIO-EYFP viral particles (0.8μl; 1013 GC/ml; Addgene #27056) were injected bilaterally into the CA1 hippocampus (coordinates relative to bregma ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAV2/9-CAG-mCherry (2.85 × 1012 genomic copies per mL, Addgene, 108685) was injected into the MLT (from the bregma ...