Labshake search
Citations for Addgene :
201 - 250 of 557 citations for IL 5 Rat CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... the hCRISPRi-V2 compact library (Addgene #83969, 5 sgRNAs/TSS) was transduced at a MOI (multiplicity of infection <1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Suppl Fig 3: AAV9-CaMKIIa-hChR2-EYFP (1:5, Addgene viral prep #26969- AAV9 ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the PMD2.G (5 μg) envelope construct (Addgene # 12259) were added to the solution ...
-
bioRxiv - Developmental Biology 2021Quote: ... using program A-30 with 1.6 µg each of GFP and tdTomato circularised targeting vectors and 5 µg single gRNA vector PX459 (5’-TATACCTAATCATTATGCCG-3’) (Addgene, 48139, a gift from Feng Zhang). Homology arms flanking the target site were amplified from genomic DNA and cloned into pBluescript II SK(+ ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Genetics 2021Quote: ... 5 μg Cas9 expression plasmid pSpCas9(BB)-2A-Puro (Addgene, PX459) was stably transfected into 8×105 DBA/2 ES cells via electroporation ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV2/9-pAAV-hDlx-hM4Di-dTomato-Fishell-5 (Addgene, 83896) at a concentration of 6+13 genome copies per ml (gc/ml) ...
-
bioRxiv - Neuroscience 2022Quote: ... titer: 5 × 1012 GC/ml (Addgene viral prep # 18917-AAV1, RRID:Addgene_18917), and
-
bioRxiv - Biophysics 2022Quote: ... 5 μM Sfp synthase (plasmid obtained from Addgene (pET-Sfp, #159617) and purified as described (Yin et al ...
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV8-nEF-Con/ Fon-TVA-mCherry (Addgene 131779, 5×1012 titer) and AAV8-EF1α-Con/Fon-oG (Addgene 131778 ...
-
bioRxiv - Neuroscience 2023Quote: ... and AAV8-EF1α-Con/Fon-oG (Addgene 131778, 5×1012 titer) were mixed in equal proportions (final titer = 2.5×1012 each ...
-
bioRxiv - Biophysics 2021Quote: ... The LC3-mEYFP plasmid was generated by inserting mEYFP from an mEYFP-C1 vector into pmRFP-LC3 (58) (a gift from Tamotsu Yoshimori, Addgene plasmid # 21075, encoding rat LC3) using digestion with NheI and BglII ...
-
bioRxiv - Cell Biology 2020Quote: ... an sgRNA (5’-TTGGCACGCCTCCTCAGGCA-3’) was sub-cloned into PX458 (Addgene, 48138). The C-terminal region of the CENP-E gene was amplified with the following primers ...
-
bioRxiv - Cell Biology 2020Quote: ... Jurkat T cells were transfected with mTurquoise-Farnesyl-5 plasmid (#55551, Addgene) 24 hours prior to the assay ...
-
bioRxiv - Biochemistry 2022Quote: ... mCherry was PCR amplified from mCherry-Alpha-5-Integrin-12 (Addgene #54970) using forward primer 54970RMmCherryaddNHis_F2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... or RB1 (5’-GCTCTGGGTCCTCCTCAGGA-3’) were cloned into the lentiCRISPRv2 (Addgene #52961) plasmid ...
-
bioRxiv - Cell Biology 2019Quote: ... mTagBFP2-Farnesyl-5 was a gift from Michael Davidson (Addgene plasmid # 55295). The Myr-BFP-IC3 construct of Prom1 was generated as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... Thermo Fisher Scientific) or scrambled control (5’-CCTAAGGTTAAGTCGCCCTCG-3’, Addgene Plasmid #26701). Viral particles were produced from 293FT cells by co-transfection with viral vectors ...
-
bioRxiv - Developmental Biology 2020Quote: ... Bot oligo – 5’ aaacGGGTGAGACCCATGTATTTc3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Cell Biology 2021Quote: mApple-Alpha-5-Integrin-12 was a gift from Michael Davidson (Addgene plasmid # 54864 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μg of PMD2.G envelope– expressing plasmids (no. 12259, Addgene) were diluted in 500 μl of jetPRIME buffer (no ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 or AAV9.syn.GCaMP8s-WPRE virus (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre animals injected with AAV2/5.EF1a.Dio.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, titer ≥ 1×10¹³ vg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... tFucci(CA)5 was a gift from Atsushi Miyawaki (Addgene plasmid # 153521).
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... top 5 sgRNAs/gene library was gift from Jonathan Weissman (Addgene #83969) (20) ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 5 EF1a-DIO-YFP (1.3 × 1013 gp/mL) (Addgene #27056)
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 µg psPAX2 (psPAX2 was a gift from Didier Trono; Addgene plasmid # 12260) and 2 µg VSVg were mixed with 30 µL X-tremeGene9 transfection reagent (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The module 5 was taken from the pAJM.847 plasmid in (41) (Addgene #108524 ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 μg of CS2-plasmid containing the ORF for Cas9 (Addgene #51307) or H2B-RFP was linearized by Not1 endonuclease digestion ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg pMDLg/RRE and 2.5 μg pRSV-REV (Addgene #14888, #12251, #12253) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... The hCRISPRi-v2 compact library (5 sgRNAs per gene, Addgene pooled library #83969) was transduced in duplicate into 330 million K562-CRISPRi-Tet-ON-((MICU1)-GFP1-10)-(tet-RFP-P2A-OMP25-GFP11 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Cell Biology 2023Quote: ... 5*10^10 genomic copies of commercially produced AAV8-TBG-Cre (Addgene #107787) or control AAV8-TBG-GFP (Addgene #105535 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- CCACCTCAACGTCAGGGTGC) was cloned into LentiCRISPRv2 vector (Addgene, 52961). Lentivirus carrying CRISPR/Cas9-PARP1 guide was transduced to HCT116 in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting ATP6V1B2 (5’- AAACTTACCATCATTAGGCA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus) ...