Labshake search
Citations for Addgene :
301 - 350 of 1188 citations for IL 5 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2022Quote: Human kinesin-5 (Kif11/Eg5) 5-513 was PCR amplified from mCherry-Kinesin11-N-18 plasmid (gift from Michael Davidson, Addgene # 55067). This fragment was previously shown to form functional dimers [19] ...
-
bioRxiv - Biochemistry 2021Quote: ... two double-stranded oligonucleotides targeting exon 2 of human SGTA (guide #1: 5′-CATGACCAGCTCCGGCACGG-3′ and guide #2: 5′- CAGGAACTGGATGATGGCGT-3′) were ligated into the pSpCas9(BB)-2A-puro vector (Addgene #62988) using BbsI sites ...
-
bioRxiv - Molecular Biology 2021Quote: ... the annealed oligos to target CRY1 (Sense: 5′ CACCGCCTTCAGGGCGGGGTTGTCG 3′; and Antisense: 5′ AAACCGACAACCCCGCCCTGAAGGC 3’) was inserted into BsmBI of LentiCRISPRv2 plasmid (Addgene #: 52961).
-
bioRxiv - Pathology 2019Quote: ... the full length genomic copy with promoter of MoDNM1 was amplified with MoDnm1-F (5’-AATT GAATTC GTTGAGCAGGCCGAGCGAC-3’) and MoDnm1-R (5’-AATT GAATTC CACTGGCATTTGATTACGCAAGG-3’) inserted into pFGL822 (Addgene, 558226) and introduced into the Modnm1Δ strain.
-
bioRxiv - Biophysics 2019Quote: ... The LRRK2 gene was cloned by using the primer sets: 5’-GCGATAACATGGCTAGTGGCAGC-3’ and 5’-GGGGTTATGCTAGTTACTCAACAGATGTTCGTCTC-3’ with pENTR221-LRRK2 (Addgene #39529) as the template ...
-
bioRxiv - Biochemistry 2021Quote: ... guide sequences 5’GGCATTGCCCGTCATGGCCC3’ and 5’GTCTTCACCGAGCTCATTAA3’ were cloned into pX330-U6-Chimeric_BB-CBh-hSpCas9 (a gift from Feng Zhang; Addgene plasmid # 42230) and co-transfected with a GFP-expressing plasmid into HCT116 cells using Lipofectamine 2000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... two separate NR2F1 guide RNAs (guide 2: 5’-GATCCGCAGGACGACGTGGC-3’ and guide 4: 5’-GGCTGCCGTAGCGCGACGTG-3’) were cloned into pLentiCRISPRv2 (Addgene #52961). A non-targeting (NT ...
-
bioRxiv - Molecular Biology 2021Quote: ... of plasmids expressing sgRNAs (5′- ATTGTGATATCCGATAGTGAT-3′ and 5′-GTTCTGTCAGTGTGAAGAGG-3′) and Cas9 followed by the 2A-Puromycin cassette (pX459, Addgene #62988). 24 h after transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... the Bmal1 coding sequence was cloned from mouse embryonic cDNA (forward primer: 5’ GGCGAATTCGCGGACCAGAGAATGGAC 3’; reverse primer: 5’ GGGCTCGAGCTACAGCGGCCATGGCAA 3’) and subcloned into the pBABE retroviral expression vector (Addgene, 1764). Retroviral vectors were transfected into Phoenix packaging cells ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligos 5’ CACCGATCACCCTCTTCGTCGCTT 3’ / 5’ AAACAAGCGACGAAGAGGGTGATC 3’ and 5’ CACCGCTTAGGCCGGAGCGAGCCT 3’/ 5’ AAACAGGCTCGCTCCGGCCTAAGC 3’ were annealed and cloned into the px458 cut with BsaI (Addgene #48138). Plasmids were transfected into cell lines using Genejuice transfection reagent (Merck ...
-
bioRxiv - Cancer Biology 2022Quote: ... gRNA sequences targeting Apc (5-CAACTTCTGGTAATGGTC-3) or Trp53 (5-AATGAGGCCTTGGAACTCA-3) were cloned into the Px330 vector (Addgene plasmid #42230). Organoids were removed from Matrigel using Dispase II (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: ... the primers 5’-AAACCTGGACCCCACCCCCAGATC-3’ and 5’-CACCGATCTGGGGGTGGGGTCCAG-3’ were annealed and cloned in the px458-pSpCas9(BB)-2A-GFP (Addgene, #48138) using the BpiI restriction site to generate a guide RNA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... was PCR amplified from genomic DNA using primers (5’ CAGGTCTCAATCCCGATGTAGAACGCGAG 3’) and (5’ CGGTCTCACATATTGTTTCCTTTCTTTATTCACCGG 3’) and was cloned immediately upstream of SpCas9 amplified from plasmid PX165 (Addgene #48137) (62 ...
-
bioRxiv - Genomics 2023Quote: ... Guide RNAs (FANCC: 5’-GCAAGAGATGGAGAAGTGTA-3’ and MSH2: 5’-GTGCCTTTCAACAACCGGTTG-3’) were cloned into pSpCas9(BB)-2A-GFP (PX458) vector (Addgene#48138). AHH-1 cells were transfected using Lipofectamine 2000 (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2023Quote: ... The SIYx3-GFP insert was generated with the primers: 5’-GGTGTCGTGAGGATCCACCATGGTGTCTATTTACAGGTAC-3’ 5’-CGCCCTCGAGGAATTCTTACTTGTACAGCTCGTCCATGC-3’ and cloned into pLV-EF1a-IRES-Blast (Addgene #85133) linearized with BamHI and EcoRI restriction enzymes (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-iLID was amplified using 5’-GGTAGTAGTGGTAGTAGTATGGTGAGCAAGGGCGA-3’ and 5’-TCGAAGCTTGAGCTCGAGATCTTTAAAAGTAATTTTCGTCGTTCGCT-3’.The fragments were inserted into a pEGFP-C1 vector (Addgene 46956) using the AgeI/BglII restriction sites.
-
bioRxiv - Developmental Biology 2024Quote: ... gcgtgtgttcccagatgtat) and PCR donor generated with primers AP677/678 (5’Biotin::taagtgccaaggctgccaggcgtgtgttcccagaaacaccccaggaatcaacc and 5’Biotin::gtttttactcacccgatcgcctttctcaccaatacacttgtcatcgtcatccttg) on plasmid AP635 (Addgene #99485). Genotyping shows scarless insertion in the coding sequence ...
-
bioRxiv - Neuroscience 2022Quote: ... Synaptophysin-pHluorin (syn-pH) was a gift from Stephen Heinemann and Yongling Zhu (Northwestern University, Evanston, IL; pcDNA3-SypHluorin 2x, Addgene plasmid # 37004). VAMP-mCherry and synaptophysin-GCaMP6f were gifts from Timothy Ryan (Weill Cornell Medicine ...
-
bioRxiv - Cell Biology 2019Quote: The human kinome ORF library in pDONOR223 was obtained from Addgene (Cambridge, MA, 1000000014) and cloned into a custom pHAGE-CMV-FLAG destination vector using Gateway cloning technology ...
-
bioRxiv - Cell Biology 2020Quote: ... pcDNA3-HA-human OCRL (76) was supplied by Pietro De Camilli (Addgene plasmid #22207). GFP-C1-PLCdelta-PH (53 ...
-
bioRxiv - Cell Biology 2022Quote: ... cDNAs of the human proteins were cloned into pTT5 based expression vectors (Addgene #52355). The constructs were tagged with Twin-Strep-tag (SII ...
-
bioRxiv - Genomics 2020Quote: Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene #1000000048) (16) ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207 ...
-
bioRxiv - Neuroscience 2020Quote: ... The Human CRISPR Libraries v.1.0 and v1.1 have been previously described (Addgene, 67989)12,42 ...
-
bioRxiv - Cell Biology 2022Quote: ... The pGEX6P1-human full-length LIC1 plasmid was a gift from Ron Vale (Addgene plasmid # 74597 ...
-
bioRxiv - Biophysics 2022Quote: The gene with codon-optimized human dysferlin cDNA was obtained from Addgene (Plasmid 67878) [47] ...
-
bioRxiv - Neuroscience 2019Quote: ... and VSV-G envelope generated by inserting human Sirt3 plasmid (Purchased from Addgene #13814) into HIV.SIN.cPPT.CMV.eGFP.WPRE (Purchased from U Penn Vector Core ...
-
bioRxiv - Cell Biology 2019Quote: ... Human B-Raf under T7 promoter was a gift from Dustin Maly (Addgene #40775) and was further modified by the insertion of two additional FLAG tags and of an RBS sequence ...
-
bioRxiv - Physiology 2020Quote: ... Human FL-Dhh sequence was obtained after EcoRI digestion of pBS hSHH (Addgene ID13996) and then cloned at the EcoRI site of pCDNA3.1 myc His to generate the pcDNA3-FL-Shh plasmid ...
-
bioRxiv - Genetics 2021Quote: We digested the human STARR-seq screening vector (hSTARR-seq_SCP1 vector_blocking 4, Addgene #99319) with both Thermo SgrDI and BshTI (AgeI ...
-
bioRxiv - Neuroscience 2021Quote: ... The human codon-optimized Cas9 (kindly made available by George Church, Addgene plasmid # 41815) and the sgRNA (encoded by a pFUS-U6 vector ...
-
bioRxiv - Biochemistry 2021Quote: The gene encoding human SLC7A11(I.M.A.G.E. clone IRAUp969G0966D) was cloned into pLexM (Addgene 99844) 53 with an N-terminal Flag tag inserted via PCR ...
-
bioRxiv - Cell Biology 2021Quote: Human SEC24D was cloned from pJK15 plasmid into pAcGFP1-C1 (Addgene, Watertown, MA, USA) to generate a GFP-SEC24D fusion gene ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Molecular Biology 2022Quote: ... shRNA to human raptor (plasmid#1857) and rictor (plasmid#1853) were purchased from Addgene. The preparation of shRNA infected HEK293 cells have been described previously (28).
-
bioRxiv - Biochemistry 2022Quote: Human PARP6 (Uniprot #Q2NL67-1) was cloned into a modified pFASTBac1 vector (Addgene #30116) with N-terminal 6X His-maltose binding protein (MBP ...
-
bioRxiv - Immunology 2022Quote: ... An amino-terminal 3xFlag epitope tagged human GLUT3 was generated by PCR (Addgene #72877) (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: Class-switched VRC07 constructs were generated from human isotype backbone plasmids obtained from Addgene. The different human heavy chain constant regions were PCR amplified from the Addgene plasmids and inserted into the previously described AAV transfer vector 11 encoding the VRC07 heavy chain variable region and VRC07 kappa light chain ...
-
bioRxiv - Molecular Biology 2022Quote: The GeCKOv2 human CRISPR knockout pooled library (a gift from Feng Zhang, Addgene #1000000048) was used as described (19 ...
-
bioRxiv - Immunology 2023Quote: ... The amplicons were cloned into human IGHG1 or IGKC or IGLC expression vectors (Addgene number 80795 ...
-
bioRxiv - Neuroscience 2023Quote: ... human TDP-43M337V has subcloned into the pLenti CMV Puro DEST (W118-1, Addgene) plasmid as previously described (Zhang et al ...
-
bioRxiv - Cancer Biology 2023Quote: Cas9-expressing DND-41 cells were transduced with Human GeCKOv2 library (Addgene 1000000048, 1000000049) at MOI~0.3 and selected with 1μg/ml of puromycin for 6 days ...
-
bioRxiv - Immunology 2023Quote: ... The CRISPR library vectors (Human CRISPR Metabolic Gene Knockout Library; Addgene, Pooled Library #110066) 12 or the single sgRNA vectors ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Cell Biology 2023Quote: The genome-wide human SAM sgRNA library (kind gift from Feng Zhang, Addgene #1000000057) was amplified as previously described (Joung et al. ...
-
bioRxiv - Biochemistry 2023Quote: Plasmids containing human BRCA1 cDNA were a gift from Junjie Chen (Addgene, Plasmid #99394). We cloned the BRCT and RING variant library by designing primers (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2023Quote: The human ASH2L sequence was introduced to the lentiviral vector pLEX305-NdTAG (Addgene#91797) using a Gateway LR reaction (Invitrogen) ...
-
bioRxiv - Physiology 2024Quote: HEK 293T were transfected with a human TLR3 plasmid or an empty vector (Addgene). Briefly ...
-
bioRxiv - Genetics 2023Quote: Plasmid mutagenesis was performed on pKS070 - pCAGGS-3XFLAG-(human) CTCF-eGFP (Addgene Plasmid #156448) for CTCF and mEmerald-RAD21-N-18 (Addgene Plasmid #54248 ...
-
bioRxiv - Animal Behavior and Cognition 2019Quote: ... for the Right Arm (5’-TACATCCCTAAGGCCTGATTACCCGAACACT-3’, 5’-TATACGCGTTGCCATGCTATTGGCTTC-3’) and cloned into pHD-DsRed-attp (Gratz et al., 2014; Addgene Plasmid # 51019) in two steps ...