Labshake search
Citations for Addgene :
1 - 50 of 552 citations for IL 10 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2024Quote: ... IL-10 (pHR_Gal4UAS_humanIL-10_T2A_PDL1_PGK_mCherry, which was a gift from Wendell Lim, Addgene plasmid #85430)9 ...
-
bioRxiv - Biochemistry 2023Quote: The roGFP-iL gene was purchased from Addgene (Watertown, MA, USA) in a pQE30 plasmid harboring an ampicillin resistance gene ...
-
bioRxiv - Molecular Biology 2023Quote: The pHis-hTGM2 plasmid was gifted from Byung Il Lee (Addgene plasmid #100719). The His6-tagged TGM2 C277A mutation was cloned by site-directed mutagenesis using pHis-hTGM2 as the template and the following primer sequences ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Neuroscience 2022Quote: ... into IL (bregma +0.175 AP, +/-0.03 ML, -0.03 DV) or injected with pAAV.hSyn.eGFP.WPRE.bGH (Addgene Cat. No. 105539-AAV9) into IL as controls ...
-
bioRxiv - Microbiology 2019Quote: ... GM-CSF and IL-4 were produced from HEK293 cells transduced with pAIP-hGMCSF-co (Addgene #74168) or pAIP-hIL4-co (Addgene #74169) ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... Erik Procko (University of Illinois at Urbana, IL) (Park et al., 2019): HLA-cMyc-EcopT1R1 (Addgene plasmid #113962), HLA-Flag-natT1R3 (Addgene plasmid #113950) ...
-
bioRxiv - Genomics 2023Quote: ... 10 μg payload DNA and 10 μg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Cell Biology 2022Quote: ... GFP1-10 plasmid (pHAGE2-EF1a-GFP1-10-IRES-Puro) was generated by cloning GFP1-10 from pcDNA3.1-GFP(1-10) (Addgene Plasmid #70219) into a lentiviral vector that contains EF-1α promoter and Puromycin selection marker ...
-
bioRxiv - Cell Biology 2023Quote: ... 5*10^10 genomic copies of commercially produced AAV8-TBG-Cre (Addgene #107787) or control AAV8-TBG-GFP (Addgene #105535 ...
-
bioRxiv - Neuroscience 2022Quote: ... The lentiviral particles were commercially produced by VectorBuilder (Chicago, IL, USA) using the established and published plasmids pLenti-FUW-M2rtTA (FUW-M2rtTA deposited by Rudolf Jaenisch, Addgene plasmid #20342 ...
-
bioRxiv - Neuroscience 2022Quote: ... 10 μL of AAV-PHPeB-hsyn-cre-eGFP (Addgene#105540, titer ∼1×10^13) or AAV-PHPeB-CAG-GFP (Addgene#37825 ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Immunology 2023Quote: ... 10 μg pMD2.G (Addgene) and 100 μL lipofectamine 2000 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... AICSDP-10:LMNB1-mEGFP (Addgene plasmid #87422 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 μg pMD2.G (Addgene) envelope plasmid and 130 μL 1 μg / mL polyethylenimine (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGEmCherry-LC3B (Addgene 201924 10).
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV9-EF1a-DIO-hChR2(H134R)-EYFP (Addgene, 1.8*10^13 gc/ml, diluted 1:10), AAV2-hSyn-hChR2(H134R)-EYFP (UNC Vector Core ...
-
bioRxiv - Neuroscience 2022Quote: ... Synaptophysin-pHluorin (syn-pH) was a gift from Stephen Heinemann and Yongling Zhu (Northwestern University, Evanston, IL; pcDNA3-SypHluorin 2x, Addgene plasmid # 37004). VAMP-mCherry and synaptophysin-GCaMP6f were gifts from Timothy Ryan (Weill Cornell Medicine ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV5 CaMKII-hM3Dq-IRES-mCitrine (3.75×10^14 or 3.75×10^13 virus molecules/mL) (Addgene plasmid #50466 ...
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 10 µg of psPAX2 (Addgene) and SARS-CoV-2-S variant (pCDNA 3.1_Spike_Del19 ...
-
bioRxiv - Cell Biology 2019Quote: ... mVenus-VE-Cadherin-N-10 (Addgene plasmid # 56340 ...
-
bioRxiv - Cell Biology 2020Quote: ... packaging (10 μg psPAX2, Addgene #12260), and envelope (6 μg pMD2.G ...
-
bioRxiv - Cell Biology 2021Quote: ... mEmerald-actin-N-10 (Addgene #53979), mEmerald-actin-C-18 (Addgene #53978) ...
-
bioRxiv - Cell Biology 2020Quote: ... mCardinal-H2B-C-10 (Addgene #56162)11 ...
-
bioRxiv - Bioengineering 2023Quote: ... and pVSV-g (10 μg) (Addgene plasmid #132776 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 10 µg psPAX2 (Addgene, Plasmid #12260), and 4.33 µg pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... and 10 μg psPAX2 (Addgene #12260)) along with 10 μg lentiviral plasmid with lipofectamine 3000 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... 10 µg LentiCRISPRv2-opti (Addgene #163126) was digested and dephosphorylated for 3 hours in a 60 µL reaction at 37 °C with FastDigest Esp3I and FastAP (ThermoFisher FD0454 and EF0654 ...
-
bioRxiv - Cell Biology 2023Quote: ... pHAGE-TEX264-GFP (Addgene 201925 10); pHAGE-TEX264(deltaLIR,F273A)-GFP (Addgene 201926 10) ...
-
bioRxiv - Cancer Biology 2022Quote: ... was purchased from VectorBuilder (Chicago, IL, USA) and the packaging plasmid psPAX2 (#12260) and envelope plasmid pMD2.G (#12259) were obtained from Addgene (Watertown, MA, USA). The plasmid GFP-pLVTHM (#12247 ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...