Labshake search
Citations for Addgene :
101 - 134 of 134 citations for IGF I Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... rats received bilateral infusion (300nL/side) of a synapsin-driven GCaMP7s-expressing virus (AAV9-hSyn-GCaMP7s-WPRE; Addgene, Watertown, USA) at the following coordinates ...
-
bioRxiv - Neuroscience 2024Quote: ... a subgroup of animals within each rat subline received AAV5-hSyn-DOI-mCherry (7.10¹² vg/mL, Addgene, plasmid number 50459). After injections ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Cell Biology 2021Quote: ... mScarlet-i-H2A construct was amplified by PCR from pmScarlet-i_H2A_C1 (a gift from Dorus Gadella, Addgene plasmid #85053) (Bindels et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... U2OS and HEK293 cells were seeded into 10 cm plates 24 h prior to transfection with 2.5 µg of the I-SceI expression vector pCBA-SceI (Addgene plasmid # 26477 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gene encoding Cas3/I-G was cloned into pET Strep II TEV LIC cloning vector (1R, Addgene #29664). All the clones were confirmed by Sanger sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... the full-length dFz2 ORF was amplified and then mScarlet-I was fused to its 3’ end (Addgene #85044). The dFz2-Scarlet fusiomn was then cloned into the UASp vector ...
-
bioRxiv - Cell Biology 2023Quote: The pMTS-mScarlet-I-N1 (mito-mScarlet) was a gift from Dorus Gadella (Addgene plasmid 85059; RRID: Addgene 85059) (Bindels et al. ...
-
bioRxiv - Cell Biology 2023Quote: The pMTS-mScarlet-I-N1 (mito-mScarlet) was a gift from Dorus Gadella (Addgene plasmid 85059; RRID: Addgene 85059) (Bindels et al. ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Neuroscience 2024Quote: ... two 5 weeks old rats habituated to tickling underwent unilateral injection of 100 nl at 30 nl/min of AAV2/5.hsyn.eGFP (Addgene, 50465-AAV5) in the insular cortex at the following coordinates ...
-
bioRxiv - Physiology 2024Quote: ... Pparg1 or Pparg2 in NIH-3T3 cells was performed by transfecting pcDNA3.1(-) rat C/EBP alpha (#12550, Addgene, Watertown, MA, USA), pcDNA-mC/EBPb (#49198 ...
-
bioRxiv - Cell Biology 2020Quote: ... An S288C nup116ΔGLFG strain was generated by cloning the nup116ΔGLFG genome sequence from SWY2791 into SnaBI- and XhoI-digested pAG306-GPD-empty chr I (Addgene 41895) using Gibson Assembly master mix (NEB E2611L) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... pHCKan-yibDp-CBD-hGLY was constructed by DNA assembly with 2 PCR products amplified from (i) a plasmid coding hGLY under a T7 promoter (pHCKan-T7-CBD-hGLY, Addgene #134940 ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were transfected with an I-SceI rare cutter endonuclease coding plasmid construct (cat #26477, Addgene Watertown, Massachusetts, USA). After 96 h of gene silencing ...
-
bioRxiv - Neuroscience 2021Quote: ... CRF1:Cre-tdTomato rats were given bilateral microinjections of AAV8-hSyn-DIO-HA-hM3D(Gq)-IRES-mCitrine (50454-AAV8, Addgene, Watertown, MA) or a control virus (AAV5-hSyn-DIO-EGFP ...
-
bioRxiv - Neuroscience 2023Quote: ... and female (n=14) rats underwent aseptic stereotaxic surgery for injection of 150nl retrograde-transducing AAV carrying fluorophore mCherry (pAAV-hSyn-mCherry; Addgene; 114472-AAVrg)) into the BLA (AP -3.0 ...
-
bioRxiv - Molecular Biology 2021Quote: ... GFP ORF was PCR-amplified and cloned between AgeI and EcoRI sited of lentiviral vector with synapsin I promoter (Addgene #20945). During this cloning AgeI site was destroyed and a new AgeI was introduced on a PCR primer downstream of GFP ...
-
bioRxiv - Molecular Biology 2020Quote: ... an oligo duplex encoding the sgRNA sequence was cloned at the Bbs I site of pX458-pSpCas9 (BB)-2A-GFP plasmid (Addgene #48138). To construct a donor vector ...
-
bioRxiv - Bioengineering 2020Quote: The following sequence for the I-Adα.TCRα chimeric CRMpMHCIIα subunit was subcloned into the pMSCV-ires-CFP II (gift from Dario Vignali, Addgene plasmid # 52109) via 5’EcoRI and 3’XhoI: gaattccgccaccatgccgtgcagcagagctctgattctgggggtcctcgccctgaacaccatgctcagcctctgcggaggtgaagacgacattgaggccgaccacgtaggcttctatggtacaactgtttatcagtctcctggagacattggccagtacacacatgaatttgatggtgatgagttgttctatgtggacttggataagaagaaaactgtctggaggcttcctgagtttggccaattgatactctttgagccccaaggtggactgcaaaacatagctgcagaaaaacacaacttgggaatcttgactaagaggtcaaatttcaccccagctaccaatgaggctcctcaagcgactgtgttccccaagtcccctgtgctgctgggtcagcccaacacccttatctgctttgtggacaacatcttcccacctgtgatcaacatcacatggctcagaaatagcaagtcagtcacagacggcgtttatgagaccagcttcctcgtcaaccgtgaccattccttccacaagctgtcttatctcaccttcatcccttctgatgatgacatttatgactgcaaggtggagcactggggcctggaggagccggttctgaaacactgggaacctgagattccagcccccatgtcagagctgacagaaactgtgtgtgatgccacgttgaccgagaaaagctttgaaacagatatgaacctaaactttcaaaacctgtcagttatgggactccgaatcctcctgctgaaagtagcgggatttaacctgctcatgacgctgaggctgtggtccagttgactcgag
-
bioRxiv - Developmental Biology 2019Quote: Ubi-SpCas9::P2A::mPicota::T2A::mCitr(#1)trine-polyA-U6c-gRN(#7)NA#1: we used multisite-Gateway cloning to recombine: i) a p5E ubi vector (34, Addgene #27320), ii ...
-
bioRxiv - Systems Biology 2022Quote: ... Transfection with siRNA or the RFP-tagged protein of interest was performed 12 hours prior to transfection with I-SceI (Addgene #26477) or GFP control (Addgene #89684) ...
-
bioRxiv - Molecular Biology 2023Quote: Plasmids for type I-F CASTs Cascade over-expression were constructed by sub-cloning the individual genes into pRSFDuet1 (Addgene #126878) to create pIF1008 ...
-
bioRxiv - Cell Biology 2023Quote: ... This phosphorylated DNA fragment was ligated to the Bbs I cloning site in pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene plasmid # 62988) [16] ...
-
bioRxiv - Cancer Biology 2023Quote: ... the I-SceI-P2A-mCherry plasmid which we generated by replacing AmCyan with I-SceI in the bicistronic plasmid Amcyan-P2A-mCherry (Addgene #45350) was delivered by nucleofection after 24 hours ...
-
bioRxiv - Neuroscience 2024Quote: pAAV CAG-FLEx-FLPo was constructed by in-fusion-based PCR cloning utilizing the following two DNA fragments: i) SalI-AscI restriction fragment of pAAV CAG-FLEx-TCb (Addgene #48332) as a vector backbone ...
-
bioRxiv - Cell Biology 2023Quote: ... and mito-PDCD10-mScarlet-I (mito-PDCD10) constructs were created by inserting a custom gene block (IDT) in the pMTS-mScarlet-I-N1 plasmid (Addgene 85059) using the XhoI/EcoRI sites ...
-
bioRxiv - Microbiology 2021Quote: ... vCyclin and vGPCR were amplified by PCR using the cDNA prepared from iSLK.219 as templates and cloned into the Bgl II and EcoR I restriction sites of the pMSCV-puro lentiviral vector (Addgene plasmid # 68469). vFLIP were cloned by inserting its PCR fragment into the modified pMSCV-puro-3HA vector at Bgl II and Xho I restriction sites ...
-
bioRxiv - Cell Biology 2021Quote: The pFHL-plasmid for dual expression was constructed using four DNA fragments: (i) the Kanamycin resistance gene and ColE1 origen of replication from a C1 plasmid (Addgene plasmid #54842), followed by (ii ...
-
bioRxiv - Cell Biology 2021Quote: ... The final constructs with the piggyBac transposon elements and Dox-inducible promoter were made by subcloning the sfGFP- or mScarlet-i-PCNT fragment into PB-TA-ERN (a gift from Knut Woltjen, Addgene plasmid #80474) (Kim et al. ...
-
bioRxiv - Biophysics 2021Quote: ... The LC3-mEYFP plasmid was generated by inserting mEYFP from an mEYFP-C1 vector into pmRFP-LC3 (58) (a gift from Tamotsu Yoshimori, Addgene plasmid # 21075, encoding rat LC3) using digestion with NheI and BglII ...
-
Efficient CRISPR/Cas9 genome editing in a salmonid fish cell line using a lentivirus delivery systembioRxiv - Genetics 2019Quote: ... Specific gRNA for EGFP and RIG-I (Table2, underlined) were cloned according to Golden Gate reaction from ZhangLab protocol (Addgene SAM library sgRNA cloning protocol) using BbsI-HF (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... The K18-Scarlet-I reporter was constructed by cloning a fusion of the K18 construct from pMK1253 in frame with the C-terminal mScarlet-I (Addgene #98839, a gift from Dorus Gadella (65)) as well as replacing the EF1a promoter with a CAG promoter to obtain pJC49.