Labshake search
Citations for Addgene :
51 - 100 of 998 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Immunology 2023Quote: Fluorescent reporter viruses were generated by transfection of a three-plasmid system: pMD2.G (Addgene, Watertown ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Molecular Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 and HEK293T were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: Fluorescent TLR1, TLR2, TLR4, TLR6, and Myd88 constructs (13014, 13015, 13016, 13018,13020) were obtained from Addgene.
-
bioRxiv - Cancer Biology 2020Quote: ... A plasmid expressing Green Fluorescent Protein (GFP) (pLJM1-EGFP was a gift from David Sabatini (Addgene plasmid # 19319 ...
-
bioRxiv - Cancer Biology 2020Quote: HeLa cells were infected with lentivirus carrying the Cas9-BFP (blue fluorescent protein) vector (Addgene 52962). HCT116 were transfected with the same vector using Lipofectamine 2000 (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: Projecting neurons were labeled with retrograde fluorescent tracers (Retrobeads, Lumafluor, and pAAV-CAG-tdTomato, Addgene 59462P). Fluorescent beads were stored at 4°C before use ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell lines were transiently transfected with a membrane-targeted fluorescent protein (glycosylphosphatidylinositol-anchored eGFP, Addgene #32601) using a TransIT-X2 transfection kit (Mirus) ...
-
bioRxiv - Biochemistry 2021Quote: The ORAI1-yellow fluorescent protein (YFP) construct was purchased from Addgene (Cambridge, MA, USA; plasmid no. 19756). Site directed mutagenesis using the Pfu Turbo DNA polymerase from Agilent Technologies (Santa Clara ...
-
bioRxiv - Neuroscience 2021Quote: ... retrograde AAV expressing enhanced blue fluorescent protein (EBFP) and Cre recombinase (AAVrg-pmSyn1-EBFP-cre, Addgene #51507) was injected into either NAc or RSC of Rosa26TdTomatoAi9 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human melanoma cell lines with fluorescent BRN2 reporter were further transduced with pHIV-Luc-ZsGreen (Addgene 39196) and selected with neomycin (800 μg/mL ...
-
bioRxiv - Neuroscience 2023Quote: Viral vectors encoding the fluorescent dopamine indicator dLight1.2 (AAV5-hSyn-dLight1.2) (Addgene, titer ≥ 4×10¹² vg/mL) and calcium indicator jRCaMP1b (AAV1.Syn.NES-jRCaMP1b.WPRE.SV40 ...
-
bioRxiv - Molecular Biology 2023Quote: ... the lentiviral vector pdCAS9-humanized (code 44246) with an engineered mCherry fluorescent signal was acquired from Addgene and transduced into K562 cells ...
-
bioRxiv - Genetics 2020Quote: A pair of TALENs targeting zebrafish tnfaip3 (A20) exon 2 were generated using “PLATINUM Gate TALEN Kit” (Addgene, #1000000043). 0.2 ng of mRNA encoding the TALEN pair was delivered into the cytoplasm of wild-type zebrafish embryos at the one-cell stage ...
-
bioRxiv - Bioengineering 2022Quote: ... with 2 μg MLC-2 plasmid (pEGFP-MRLC1, Addgene, #35680), 10 μg RAR-β siRNA (Santa Cruz ...
-
bioRxiv - Neuroscience 2023Quote: ... virus for optogenetic inhibition or excitation of preBötCOT-R neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 154951 ...
-
bioRxiv - Neuroscience 2023Quote: ... The AAV1-phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE virus for tracing experiments from preBötCOT-R neurons to nACardiac neurons in OT-R::Cre mice was obtained from Addgene (Table 2, Addgene viral prep # 51509 ...
-
bioRxiv - Cell Biology 2022Quote: ... mRFP-GFP tandem fluorescent-tagged LC3 (tfLC3) was a gift from Tamotsu Yoshimori (Addgene plasmid # 21074; www.addgene.org/21074)51 ...
-
bioRxiv - Microbiology 2022Quote: ... 1µg of lentiviral vector bearing green fluorescent protein (GFP) (PLV-eGFP) (gift from Pantelis Tsoulfas, Addgene plasmid # 36083) 90 using Jetprime transfection reagent (Polyplus ...
-
bioRxiv - Cell Biology 2021Quote: ... Of the following vectors the fluorescent protein was exchanged for Tq-Ca-FLITS: 3xnls-mTurquoise2 (Addgene plasmid #98817) for a nuclear tag ...
-
bioRxiv - Cell Biology 2019Quote: ... replacing the mCherry coding sequence in pFA6a-mCherry:Hph with the coding sequence for the photo-switchable fluorescent protein mEOS3.2 (5) (Addgene) by standard restriction-digestion cloning (using restriction enzymes BamHI and AscI ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ; http://n2t.net/addgene:167585 ; RRID:Addgene_167585).
-
bioRxiv - Cell Biology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid #72486; http://n2t.net/addgene:72486;RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Physiology 2022Quote: ... promoter and upstream of a P2A linker followed by the tdTomato fluorescent protein (gift from Kazuhiro Oka;Addgene plasmid # 72486; http://n2t.net/addgene:72486; RRID:Addgene_72486). To obtain a >98% transduced population ...
-
bioRxiv - Cancer Biology 2024Quote: Plasmids for expression of lipid anchored fluorescent proteins were obtained from the Addgene repository: MyrPalm-CFP (Addgene #14867) and MyrPalm-GFP (#21037) ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Biophysics 2021Quote: Monomeric and multimeric fluorescent controls were derived by modifying previously published plasmids designed to express CD86-EGFP (Addgene # 133858) and mApple-CD86-EGFP (Addgene #133860 ...
-
bioRxiv - Microbiology 2022Quote: ... with a 15 base pair overlap with vector backbone were used to amplify destabilised enhanced green fluorescent (d2EGFP) fragment from pcDNA3.3_d2eGFP plasmid (Addgene 26821). A fragment containing 9 copies of TRE type 1 and TRE type 3 and an HTLV-1 promoter was amplified from SMPU-18×21-EGFP plasmid [86] by PCR using forward (5’-AAATGGACTATCATATGCGGGTTTATTACAGGGACAGCG-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... The lentiviral vector plasmid pSICO-CPSF6-mNeonGreen encoding CPSF6 fluorescent fusion protein was a gift from Zandrea Ambrose (Addgene plasmid # 167585 ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Microbiology 2023Quote: ... originally obtained from the laboratory of Sydney Kustu.94 Perturbations of intracellular ppGpp concentrations were performed using a genetic system as described in Büke et al.70 These plasmids (without fluorescent tags) were ordered from AddGene (pRelA’ AddGeneID:175595 ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-eGFP, Addgene) was also infused bilaterally into either BLA (n=7) ...
-
bioRxiv - Bioengineering 2023Quote: ... by transfection with the lentiviral transfer vector plasmid (pWPI) that contains enhanced green fluorescent protein (eGFP) (Addgene plasmid # 12254), and provided by Dr ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV2/2 (Addgene 104963), adenovirus helper plasmid pAdDeltaF6 (Addgene 112867 ...
-
bioRxiv - Microbiology 2020Quote: ... The plentiCRISPRV.2 (Addgene) was digested with BsmBI and ligated with guide RNA sequences specific for IFNAR1 ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/2 (Addgene #104963), pAAV2/5 (Addgene #104964) ...
-
bioRxiv - Cell Biology 2020Quote: ... the Cas9 and mCherry for detection of electroporated cells were obtained from Addgene (plasmids #66939, #66940, #66941). All targeting constructs (for both HDR and NHEJ ...
-
bioRxiv - Microbiology 2021Quote: Mycobacterium marinum (ATCC 927) with the pTEC27 plasmid expressing the red fluorescent protein tdTomato (Addgene #30182, http://n2t.net/addgene:30182) (29 ...
-
bioRxiv - Cancer Biology 2020Quote: ... A549 cells were retrovirally transduced with a construct coding for the N-terminus of 53BP1 fused to the sequence coding for fluorescent mCherry-protein (Addgene Catalog # 19835 ...
-
bioRxiv - Microbiology 2021Quote: ... Transfection efficiency was calculated by separately transfecting an enhanced green fluorescent protein (EGFP) expression plasmid pcDNA3-EGFP (pcDNA3-EGFP was a gift from Doug Golenbock (Addgene plasmid # 13031 ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus (AAV) vector expression imaging of enhanced green fluorescent proteins (eGFP): Stereotaxic injection of AAV8-CAG-GFP (Addgene ID ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene) was also infused into OFC in separate groups of animals as a null virus control ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV engineered for retrograde transport and carrying either tdTomato or green fluorescent protein (AddGene, AAVrg-CAG-tdTomato, AAVrg-CAG-GFP) in PBS was injected using a Nanoject II (Drummond ...
-
bioRxiv - Neuroscience 2019Quote: ... The intracellular solution also contained 50 µM of the red fluorescent dye AlexaFluo 594 and 3 plasmids with the following concentrations42: 100µg/µL pCAG-dsRed2 (Addgene #15777), 200 µg/µL pCMV-oG48 (Addgene 74288 ...
-
bioRxiv - Cell Biology 2019Quote: ... The nuclear red fluorescent protein (RFP)-expressing lentiviral construct (LV-RFP) was a gift from Elaine Fuchs (Addgene plasmid # 26001). To infect lentiviruses ...
-
bioRxiv - Cell Biology 2020Quote: ... Green fluorescent protein-tagged HIF-1α DM(P402/564A) was generated by inserting the sequence of Clover (Addgene plasmid #40259) behind the myc-tag in the BamHI-digested pCMV-Myc-HIF-1α DM(PP/AA ...
-
bioRxiv - Cell Biology 2020Quote: ... The following plasmids were used as templates for the fluorescent proteins: H2B-TagRFP (Addgene #99271, a gift from Philipp Keller), mCardinal-H2B-C-10 (Addgene #56162)11 ...
-
bioRxiv - Biochemistry 2022Quote: For the generation of BiFC chimeric plasmids including the Nt or Ct of the Venus Fluorescent Protein (VN, VC, respectively) plasmids were modified (Addgene #27097 ...
-
bioRxiv - Neuroscience 2022Quote: ... to express two fluorescent proteins with different colors in presynaptic areas (AAV2-retro-GFP and pAAV2-retro-tdTomato, Addgene # 59462). The aim was to test whether the labeled presynaptic circuits would differ substantially if the injection location was slightly jittered ...