Labshake search
Citations for Addgene :
501 - 550 of 998 citations for Hydrogen Peroxide Fluorescent Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... One microliter of endo-free purified (2 ug/ul) pCAG-EGFP plasmid (Addgene, cat# 89684) mixed with 0.05% Fast Green (Sigma ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Neuroscience 2023Quote: ... Retro-AAV2 coding for mCherry (pAAV2-hSyn-mCherry, Addgene #114472, 2 x 1013 GC/ml) and green fluorescent protein (pAAV2-hSyn-eGFP ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2022Quote: ... pTwist-EF1alpha-SARS-CoV-2-S-2xStrep (a gift from Nevan Krogan, Addgene plasmid # 141382) was used to express S-protein from the original SARS-CoV-2 strain (WT) ...
-
bioRxiv - Genetics 2023Quote: ... 5 µl of a solution containing a Cre-GFP plasmid (∼2 µg/µl, Addgene #13776) and phenol red (0.1% Sigma #P0290 ...
-
bioRxiv - Molecular Biology 2023Quote: 2 µg total of multiplex sgRNA vector and EF1α-dCas9-VPR-Puro vector (Addgene #99373) at a 2:1 molar ratio were mixed with 5 µl of Lipofectamine 2000 (Thermo ...
-
bioRxiv - Biophysics 2022Quote: SARS-CoV-2 S HexaPro plasmid was a gift from Jason McLellan (Addgene plasmid # 154754). This plasmid contains CMF promotor driven expression of the SARS-COV-2 Spike-B.1 ectodomain (1-1208 AAs ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... encoding the Luc mRNA with the SARS-CoV-2 packaging signal in 3’-UTR (Addgene), were co-transfected with plasmids expressing the SARS-CoV-2 nucleocapsid (nCoV-2-N) ...
-
bioRxiv - Genomics 2023Quote: ... guide pair 2: TTGCGGCGCTGTGGCGCCGA and CGCTCCCGCAAGTGGATGTC) and were cloned into the pX458 plasmid (Addgene, #48138) as previously described [49] ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected organoids for 2 weeks with the AAV1-hSYN-eGFP virus (Addgene, 105539-AAV1), which directs expression of eGFP under the neuron-specific synapsin promoter ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cells were co-transfected with enveloping (pCMV14-3X-Flag-SARS-CoV-2 S (Addgene #145780) for PVs or pMD2.G (Addgene #12259 ...
-
bioRxiv - Biochemistry 2023Quote: ... pEvol-pAzFRS.2.t1 was a gift from Farren Isaacs [Amiram et al 2017] (Addgene plasmid # 73546 ...
-
bioRxiv - Biochemistry 2023Quote: ... coli BL21 (DE3) cells using the plasmid pRSFDuet-1/CylLL/CylM-2 (Addgene ID #208759), following the method previously reported.9 For the preparation of lanthionine standard ...
-
bioRxiv - Cell Biology 2023Quote: ... The sgRNA sequences (Extended Data Table 2) were inserted into the pDD162 vector (Addgene #47549) by linearizing the vector with 15 base pairs (bp ...
-
bioRxiv - Cell Biology 2023Quote: ... The cells were co-transfected with 2 μg lentivirus packaging plasmids (pMD2.G (Addgene #12259) and 10 μg psPAX2 (Addgene #12260) ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5’-AAACCCTTATTCGTACGTGGCT-3’) foxl2l#1 and foxl2l#2 fragments were cloned into pT7-gRNA (Addgene) through one-step digestion and ligation respectively ...
-
bioRxiv - Molecular Biology 2024Quote: Neurogenin 2 (NGN2) was expressed in iPSC lines using a tetracycline inducible promoter (Addgene 172115) integrated using Piggybac plasmid EFa1-Transposase (Addgene plasmid 172116 ...
-
bioRxiv - Immunology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Biochemistry 2024Quote: ... two all-in-one CRISPR-Cas9 vectors were generated from pX330A-1×2 (58766, Addgene) and pX330S-2-PITCh (63670 ...
-
bioRxiv - Microbiology 2024Quote: ... The plasmid pcDNA3.1 SARS-CoV-2 S D614G was a gift from Jeremy Luban (Addgene plasmid # 158075 ...
-
bioRxiv - Genetics 2022Quote: ... Flox cells were grown in 24-well plates for 24h and then transfected with 130ng of H2B-GFP plasmid (Addgene, 11680). After 5h ...
-
bioRxiv - Cancer Biology 2021Quote: MEFs were seeded in 6-well plates and transfected for 6-8 h with 1 μg of plasmid 4XCLEAR-luciferase reporter (Addgene, 66800) and 0.1 ug of CMV-Renilla Luciferase (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were plated in 24-well plates and transfected with YAP/TAZ luciferase reporter 8XGTIIC-lux plasmid (50 ng/cm2) (Addgene 34615) together with CMV-lacZ (75 ng/cm2 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... approximately 500,000 cells in 6-well plates were transfected with 2000ng dCas9-KRAB-MeCP2-containing PiggyBac expression plasmids (Addgene plasmid #110821) and 400ng of transposase vector PB200PA-1 using PEI ...
-
bioRxiv - Immunology 2021Quote: ... HEK293T cells were seeded in 6-well plates and the next day transfected with 1 μg psPAX2 packaging plasmid (Addgene 12260), 500 ng pMD2.G VSV-G envelope plasmid (Addgene 12259 ...
-
bioRxiv - Immunology 2021Quote: ... Platinum-E cells were transfected at 70-80% confluency on 10 cm plates with 4 μg pCL-Eco(40) and 6 μg of either pMSCV-pBabeMCS-IRES-RFP (Addgene; 33337) or pMSCV-Myc-IRES-RFP (Addgene ...
-
bioRxiv - Genetics 2019Quote: ... Cells were then seeded in a 12 well plate prior transfection (protocol stated above) of the spCas-9 expression vector (Addgene #44758), gRNA and homologous region and a non-homologous recombination inhibitor (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... in DMEM+10% FBS supplemented with 20 μg/ml G418 to select for transduced cells.Selection was repeated for 6 passages and selected cells were expanded into 24 well plates and transfected with pX330-U6-Chimeric_BB-CBh-hSpCas9 (#42230; Addgene, Watertown, MA) by Trans IT LT-1 (Mirus Bio ...
-
bioRxiv - Molecular Biology 2023Quote: 1.6 x 108 A375 cells were transduced into thirty-two 150 mm plates with lentivirus carrying The Toronto Knockout Library v3 (TKOv3, Addgene # 90294) in standard culture media + 8 µg/mL polybrene ...
-
bioRxiv - Developmental Biology 2023Quote: ... lentiviral supernatants were generated by transfecting one 10-cm plate of HEK-293T cells at 90% confluency with 3 µg pMD2.G (Addgene #12259), 9 µg psPAX2 (Addgene #12260) ...
-
bioRxiv - Genetics 2023Quote: We plated 550,000 HEK293T cells on 6-well plates and 24 hours later we transfected the cells with 900 ng psPAX2 packaging vector (Addgene #12260), 360 ng pMD2.g VSV-G envelope vector (Addgene #12259) ...
-
bioRxiv - Immunology 2024Quote: 8 x 105 293T cells were seeded in 6-well plate and transfected with pcDNA3-FLAG-VSVG plasmids (Addgene, plasmid 80606) for 24 hours with 50 μl of purchased or previously collected VSVΔG-Luc pseudovirus (Kerafast ...
-
bioRxiv - Cell Biology 2024Quote: ... control or mir-218-1-overexpressing HTR8 cells were seeded into 12-well plates and were co-transfected with 1 µg/mL of 5X NFκB luciferase reporter (64) (Addgene plasmid #12453) construct and 20 ng/mL of Renilla luciferase vector (Promega ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1x penicillin/streptomycin (pen/strep; PAA) and distributed in 6-well plates with HEK293 cells transfected with Neo1.a-AP-His (Addgene #71963) or pcDNA3.1-CNTN4-FLAG ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cerevisiae Advanced Gateway Destination Vector Kit (Addgene) were used to perform Gateway Cloning (69) ...
-
bioRxiv - Microbiology 2021Quote: ... which was obtained from Addgene (Kit #1000000137). Initially the aph coding sequence in pAJM.011 was replaced by the bla coding sequence ...
-
bioRxiv - Cancer Biology 2019Quote: The CRISPR kit used for constructing multiplex CRISPR/Cas9 vectors was a gift from Takashi Yamamoto (Addgene kit #1000000054). Guide RNAs targeting LRP5 and LRP6 were designed using the Zhang Lab Optimized CRISPR Design Tool (http://crispr.mit.edu) ...
-
bioRxiv - Plant Biology 2022Quote: ... a modular cloning system was employed using MoClo Tool Kit and MoClo Plant Parts kit (Addgene, Supplemental Table S3) (Weber et al. ...
-
bioRxiv - Cell Biology 2019Quote: Plasmids: 0.5×106 target cells were cultured in 6-well plates and transfected with pEGFP-SKL (Addgene#53450 from Jay Brenman Lab) plasmids using TurboFect Transfection Reagent (Thermo-Scientifics R0531 ...
-
bioRxiv - Cancer Biology 2019Quote: ... cells were plated at 70-80% confluence in 6 well plates and transfected with 1μg of each plasmid containing 7a and 7b sgRNAs (Addgene #113620 and #113624) using Lipofectamine 2000 (ThermoFisher ...
-
bioRxiv - Developmental Biology 2023Quote: To measure mitophagy in HUVEC were seeded in 6-well plates (8 x 105 cells/well) and transfected with 5ug/well of pCHAC-mt-mkeima plasmids (Addgene plasmids #72342) at a ratio of 1:1.5 plasmids ...
-
bioRxiv - Genomics 2023Quote: ... 16 ug of plasmid were prepared for each plate at a ratio of 4:3:1 (sgRNA library: psPAX2(Addgene ID 12259): pMD2G(Addgene ID 12260)) ...
-
bioRxiv - Developmental Biology 2023Quote: HEK293T cells were plated at a density of 2.8×105 cells in 6-well plates and transfected with MSCV-flag-PRDM16 (Addgene, 15504; RRID:MSCV PRDM16) and/or pCDNA3-NKX2-174 using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).