Labshake search
Citations for Addgene :
351 - 400 of 10000+ citations for Human UFL1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Optimized RNA-targeting CRISPR/Cas13d technology outperforms shRNA in identifying essential circRNAsbioRxiv - Molecular Biology 2020Quote: ... The oligonucleotides for shRNA were cloned into the pLKO.1-TRC vector (Addgene #10878) using AgeI/EcoRI ...
-
bioRxiv - Genetics 2022Quote: ... UAS-shRNAs were generated according to the TRiP protocol using the pVALIUM20 vector (Addgene) (64) ...
-
bioRxiv - Molecular Biology 2023Quote: ... we cloned the shRNA targeting TET2 into the pLKO.1-blast vector (Addgene #26655). Plasmids were generated using PCR ...
-
bioRxiv - Cancer Biology 2024Quote: ... the shRNA constructs were packaged into second-generation virus particles using psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2μg of target shRNA construct and 2μg of 3:1 ratio of psPAX2 (Addgene) and pMD2.G (Addgene ...
-
bioRxiv - Cell Biology 2019Quote: ... gRNA plasmid (Addgene plasmid #103854) and non-targeting gRNA plasmid (Addgene plasmid #103868 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Plasmids pIB166 (Addgene plasmid # 90189), pIB184-Km (Addgene plasmid # 90195 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Plasmids psPAX2 (Addgene plasmid, 12260) and pMD2.G (Addgene plasmid ...
-
bioRxiv - Cell Biology 2024Quote: ... PAX2 plasmid (Addgene, Plasmid # 35002) and pMD2.G plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2021Quote: Cas9-expressing stable cell lines were produced by infection with the lentivirus encoding human codon-optimized Streptococcus pyogenes Cas9 protein (LentiV_Cas9_puro, Addgene plasmid # 108100) and subsequent selection with 1 μg/mL puromycin ...
-
bioRxiv - Neuroscience 2022Quote: The pCMV-hEAAT2 plasmid encoding the human excitatory amino acid transporter type 2 (EAAT2) was a gift from Susan Amara (Addgene plasmid # 32814 ...
-
bioRxiv - Cell Biology 2019Quote: ... and 5’-CAGCGGAGCCCAGTAGATTC-3’ (exon19) (Raaijmakers et al., 2018) were cloned into the human codon optimised SpCas9 and chimeric guide expression plasmid (pX330, Addgene) using BbsI as previously described (Ran et al. ...
-
bioRxiv - Biophysics 2019Quote: Expression of N-terminally acetylated human αS and βS proteins was performed via co-expression with pNatB plasmid (Addgene #53613) in E ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Cancer Biology 2020Quote: HEK-293T cells were transfected with the human PSD4 containing pLV lentivirus (VB160428-1095xdp – Vector Builder) together with the 3rd generation lentiviral packaging plasmid (Addgene): pMDLG/pRRE (Gag and Pol) ...
-
bioRxiv - Plant Biology 2020Quote: The human codon-optimized CAS9 with 2×35S CaMV promoter and Nos terminator was amplified from pAGM4723 plasmid (Addgene# 49772) using KpnI forward and PacI reverse primers (Supplemental Table 9) ...
-
bioRxiv - Molecular Biology 2020Quote: Human Drosha cDNA with a Flag-tag at the amino-terminus was cloned into pBABE-puro vector (Addgene plasmid#1764) for producing retrovirus of human Drosha wild type (WT) ...
-
bioRxiv - Neuroscience 2020Quote: ... Human His-tagged SETD1A expression pET28-SETD1A-MHL plasmid and its control pET28-MHL were gifts from Cheryl Arrowsmith (Addgene plasmid # 32868 and #26096 ...
-
bioRxiv - Cell Biology 2021Quote: ... and GFP-hRab31.dn3 (#1019) plasmids encoding GFP-labeled versions of the indicated human wild-type proteins were from Addgene (Cat# 49549 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding human RTCB was cloned into the UC Berkeley MacroLab 4B vector (gift from Scott Gradia, Addgene plasmid #30115). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in Sf9 insect cells using the Bac-to-Bac Baculovirus expression system (Invitrogen) ...
-
bioRxiv - Immunology 2020Quote: ... 1.5ugs of each hU6_sgRNAs and 3ugs a plasmid expressing human codon-optimised CAS9 driven by the CMV promotor (Addgene # 41815). 48 hours post transfection the media was changed for G418 selection media ...
-
bioRxiv - Genetics 2020Quote: Two pairs of gRNAs (Table S1 in “Supplementary file”) intermediated by human U6 (hU6) promoter were cloned after hU6 promoter of the plentiCRISPR_V2 plasmid (Addgene, #52961), according to Vidigal et al.’s protocol 34 ...
-
bioRxiv - Cell Biology 2022Quote: ... BirA-ACLY constructs were generated by inserting human ACLY into pcDNA3.1 mycBioID vector (N-terminal MYC-BirA, Addgene, plasmid 35700) with a 16 or 46 amino acid linkers between ACLY and BirA ...
-
bioRxiv - Biophysics 2022Quote: ... and 32C (residues 172–270 of RPA2) domains of human RPA were PCR amplified using p11d-tRPA plasmid (Addgene plasmid102613) (Henricksen et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... pMSCV-p19Ink4d-IRES-GFP plasmid expressing mouse p19INK4d (sharing 87% sequence identity with human p19INK4d) (61) was obtained from Addgene.
-
bioRxiv - Molecular Biology 2022Quote: ... a plasmid expressing human Ago2 fused to GFP in the N-terminal region of Ago2 was obtained from Addgene (11590). For recombinant protein purification ...
-
bioRxiv - Microbiology 2022Quote: ... The Jun-Nt VFP (Jun) and Fos-Ct VFP (Fos) and the human ACE2 and TMPRSS2 expressing plasmids were obtained from Addgene (#22012 ...
-
bioRxiv - Neuroscience 2023Quote: ... The Ube3a expression construct was generated by amplifying the coding sequence of human Ube3a isoform III from Plasmid #37605 (Addgene) with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237) ...
-
bioRxiv - Developmental Biology 2023Quote: ... The coding sequence of the catalytic domain of human KDM6B (1025–1680 aa) was obtained from the MSCV_JMJD3 plasmid (Addgene #21212) (Sen et al. ...
-
bioRxiv - Microbiology 2023Quote: ... targeting the first exon of the human AHR gene (NM_001621) was cloned into BsmBI-digested Cas9 plasmid lentiCRISPR v2 (Addgene #52961). The resulting plasmid (pLentiCRISPRv2-sgAhR ...
-
bioRxiv - Cell Biology 2023Quote: ... pAP1σ1-RFP (for expression of fluorescently-tagged APα1 in human cells) was cloned by Gibson assembly using sequences derived from pAP1α1-eGFP (Addgene plasmid 53611) and pTagRFP-RAB2A (provided by S ...
-
bioRxiv - Microbiology 2022Quote: ... sequences targeting human SFPQ were designed using the CRISPOR tool (http://crispor.tefor.net) and cloned into pX459-V2 vector (Addgene Plasmid #62988). Briefly ...
-
bioRxiv - Microbiology 2023Quote: Human and cat ACE2 expressing lentiviral plasmids (pscALPS-hACE2 and pscALPS-cACE2) were obtained from Addgene (158081 and 158082, respectively). Each gene was tagged with a c-terminal Myc-tag epitope to facilitate detection ...
-
bioRxiv - Cancer Biology 2023Quote: Human AKT1_D274A was generated by overlapping PCR mutagenesis using wild-type AKT1 (a gift from Thomas Leonard, Addgene plasmid 8656133) and cloned into a pAceBac1 vector with N-terminal His10-StrepII-(tev ...
-
bioRxiv - Neuroscience 2023Quote: ... The Scrib-Flag plasmid was generated by amplifying human Scrib coding sequence from MSCV Puro SCRIB WT (Addgene, Cat# 88886) and fused with 3xFlag tag at the C-terminal in pcDNA3 backbone ...
-
bioRxiv - Cancer Biology 2023Quote: ... sgRNAs targeting mouse and human genes of interest (see Supplementary Table 2) were cloned into plenti-sgRNA (Addgene plasmid #71409) using BsmbI and into Cas9 plasmid (Addgene plasmid #62988)(Ran et al ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Molecular Biology 2020Quote: shRNAs targeting PUS7 and RPUSD4 were cloned into the lentiviral vector pLKO-Tet-On (Addgene) digested with AgeI-HF and EcoRI-HF to remove the stuffer sequence ...
-
bioRxiv - Cancer Biology 2020Quote: Two distinct shRNA for each target gene were cloned into pLKO.1 puro (Addgene #8453) according to the corresponding protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... Scramble shRNA was used for control electroporations and was a gift from David Sabatini (Addgene plasmid # 1864 ...
-
bioRxiv - Cancer Biology 2019Quote: Two independent shRNA vectors targeting RB1 were obtained from Addgene (Addgene ID: 25640 and 25641). Lentivirus was produced using standard virus production methods by co-transfecting target and packaging plasmids into HEK293T cells ...
-
bioRxiv - Cancer Biology 2023Quote: AW13516 cell lines stably expressing either non-targeting scrambled shRNA (#1864) (Addgene, Cambridge, Massachusetts, USA) or shRNAs targeting C1QBP or TRIM23 were employed to study the effect of knockdown on the tumorigenic potential of cancer cells ...
-
bioRxiv - Biochemistry 2024Quote: ... shRNA sequences targeting murine ACLY or non-targeting controls were cloned into LT3-GEPIR (Addgene), the shRNA sequences used were (TGCTGTTGACAGTGAGCGACCGCAGCAAAGATGTTCAGTATAGTGAAGCCACAGA TGTATACTGAACATCTTTGCTGCGGCTGCCTACTGCCTCGGA) ...
-
bioRxiv - Genomics 2020Quote: ... transfected with lentiviral transfer plasmids and packaging plasmids helper plasmids pCMV-VSV-G (Addgene plasmid #8454) and pCMVR8.74 (Addgene plasmid #22036 ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmids were obtained from Addgene (Plasmid#50477 and Plasmid#114469) and packaged by Vigene after in house plasmid preparation ...
-
bioRxiv - Cancer Biology 2019Quote: ... Packaging plasmids psPAX2 (Addgene plasmid # 12260) and pMD2.G (Didier Trono ...
-
bioRxiv - Microbiology 2021Quote: Plasmid pVSVΔG-eGFP (Addgene plasmid #31842) was modified to pVSVΔG-Rluc to generate LASV GPC pseudotyped viruses (LASVpv) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmids for SUV39H2 (Addgene plasmid #25115) and G9a (Addgene plasmid #25503 ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid pX330 (Addgene plasmid 42230) designed for the CRISPR-Cas9 system [25 ...
-
bioRxiv - Immunology 2021Quote: ... psPAX2 packaging plasmid (Addgene plasmid #12260), and pMD2.G envelope plasmid (Addgene plasmid #12259) ...