Labshake search
Citations for Addgene :
1 - 50 of 819 citations for Human STEAP family member 1B STEAP1B ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... and 1B vector (Addgene #29653), respectively and proteins were purified as previously described (Hambarde et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding amino acids Phe2-Asp101 of human CGI-99 was cloned into the UC Berkeley MacroLab 1B vector (Addgene plasmid # 29653). The fusion protein containing an N-terminal His6 tag and a TEV protease cleavage site was expressed in BL21 (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... The ShCas12k gene was inserted into the 1B (Addgene 29653) and 1R (Addgene 29664 ...
-
bioRxiv - Biochemistry 2019Quote: ... were cloned into UC Berkeley Macrolab vector 1B (Addgene #29653) to generate N-terminal fusions to a TEV protease-cleavable His6-tag ...
-
bioRxiv - Biochemistry 2021Quote: ... The ShCas12k gene was inserted into the 1B (Addgene 29653) and 1R (Addgene 29664 ...
-
bioRxiv - Biochemistry 2023Quote: ... The EcSduA gene was inserted into the 1B (Addgene: 29653) plasmid using ligation-independent cloning (LIC) ...
-
bioRxiv - Genetics 2023Quote: ... 1B in destination vector pENTRR4-ATCC-LacZ-GCTT (Addgene# 173668). The full annotated plasmid sequence is provided in Suppl ...
-
bioRxiv - Biophysics 2022Quote: ... The FnCas12a gene was inserted into the 1B plasmid (Addgene #29653) using ligation-independent cloning (LIC) ...
-
bioRxiv - Biochemistry 2021Quote: ... The ShTnsB gene and truncated derivatives were inserted by LIC into 1B (Addgene 29653) and 1C (Addgene 29659 ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9-CAG-FLEX-EGFP (Suppl. Fig. 1B; Salk Vector Core; 1.4 x 1012; Addgene plasmid #51502); AAV1-hSyn-DIO-mRuby2-T2A-Synaptophysin-EGFP (Knowland ...
-
bioRxiv - Microbiology 2023Quote: Full length WT gp210 and mutant genes were cloned into UC Berkeley Macrolab vector 1B (Addgene #29653) to generate N-terminal fusions to a TEV protease-cleavable His6-tag ...
-
bioRxiv - Bioengineering 2019Quote: ... The pET His6 TEV LIC cloning vector (1B) was a gift from Scott Gradia (Addgene plasmid # 29653; RRID:Addgene_29653). Dextran sulfate 40 kDa was purchased from Carl Roth (Karlsruhe ...
-
bioRxiv - Bioengineering 2019Quote: ... The pET His6 TEV LIC cloning vector (1B) was a gift from Scott Gradia (Addgene plasmid # 29653; RRID:Addgene_29653). Dextran sulfate 40 kDa was purchased from Carl Roth (Karlsruhe ...
-
bioRxiv - Bioengineering 2019Quote: sgRNA sequences for suppression studies (Supplementary Table 1b) were inserted via the BbsI restriction site into eSpCas9(1.1) (Addgene #71814), which contains the human U6 promoter (hU6 ...
-
bioRxiv - Biochemistry 2019Quote: PSHCP1-56 and PSHCP1-62 were cloned into the ligation independent cloning vector (1B) which was a gift from Scott Gradia (Addgene, 29653). Plasmids containing PSHCP were transformed into BL21 (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... and CstF77 (Uniprot Q12996-1) were cloned into ligation-independent cloning (LIC) expression vectors 1B (gift from Scott Gradia, Addgene plasmid #29653), 1M (Addgene plasmid #29656) ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’ – CCGTTATCCACTTCCAATCCCTCGCAGACAGCGAA TTAATTCCAGCA – 3’ and were designed for overlap with pET His6 TEV LIC cloning vector (1B) (a gift from Scott Gradia, Addgene plasmid #29653). The pET His6 TEV LIC cloning vector (1B ...
-
bioRxiv - Genetics 2019Quote: ... These sites were used for the subsequent directional cloning (1st cloning site in Figure 1A) into the pMPRA1 plasmid (Addgene ID# 49349, Figure 1B). The plasmids were used to transform E.Coli by electroporation ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Cell Biology 2020Quote: ... human KLF4 (RRID:Addgene_17219), human c-MYC (RRID:Addgene_17220 ...
-
bioRxiv - Cell Biology 2020Quote: ... human SOX2 (RRID:Addgene_17218), human KLF4 (RRID:Addgene_17219) ...
-
bioRxiv - Neuroscience 2022Quote: ... human DNAJB4 (Addgene) and DNAJB6 (Addgene ...
-
bioRxiv - Biochemistry 2021Quote: ... and pT7-EGFP-C1-HsDCP2 were gifts from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... pT7-EGFP-C1-HsDCP1a was a gift from Elisa Izaurralde (Addgene plasmid # 25030 ...
-
bioRxiv - Cell Biology 2023Quote: ... they were electroporated with Yamanaka’s plasmids (plasmid numbers 27078 (human SOX2 and KLF4), 27080 (human L-MYC, LIN28), 27077 (human OCT3/4, shRNA against TP53) from Addgene, www.addgene.org ...
-
bioRxiv - Biophysics 2019Quote: ... human DCX (Addgene #83928), mouse DCLK1 (Transomics #BC133685) ...
-
bioRxiv - Cell Biology 2020Quote: ... human c-MYC (RRID:Addgene_17220) and ESRG (6 μg each ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Neuroscience 2023Quote: ... were cloned by PCR amplification of the full-length human GPCR cDNA library (hORFeome database 8.1) or the PRESTO-Tango GPCR Kit36 (Addgene Kit #1000000068). To optimize the 5-HT sensors ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Neuroscience 2022Quote: ... including the human IgG1 Fc (Addgene #145165), and mouse IgG1 Fc (Addgene #28216 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Microbiology 2024Quote: ... The human RAB6Q72L was subcloned from Addgene plasmid #49483 into a bacteria expression pGEX-4T-1 vector encoding a N-terminal GST tag followed by a TEV cleavage site.
-
bioRxiv - Neuroscience 2021Quote: ... The BoxB reporter was pAc5.1C-Fluc-Stop-5BoxB (a gift from Elisa Izaurralde; Addgene plasmid #21301) (Behm-Ansmant et al. ...
-
bioRxiv - Cancer Biology 2023Quote: An XRN1 open-reading frame (ORF) clone deposited by Elisa Izaurralde was purchased from Addgene (#66596). The entire ORF was sequenced to confirm fidelity to the NCBI Reference Sequence NM_019001.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...