Labshake search
Citations for Addgene :
451 - 500 of 1835 citations for Human Protein Patched Homolog 2 PTCH2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... TERT+ cells were transiently transfected with human CA-FOXO1 (pcDNA3 Flag-FKHR-AAA mutant; Addgene) (15) ...
-
bioRxiv - Cancer Biology 2023Quote: ... we amplified mutant human HIF1/2α using the pcDNA3-HA-HIF1α(P402A/P564A) (Addgene #18955) plasmid and the pcDNA3-HA-HIF2α(P405A/P531A ...
-
bioRxiv - Cancer Biology 2023Quote: The Toronto human knockout pooled library (TKOv3) was a gift from Jason Moffat (Addgene #90294). The library was amplified in bacteria as described in the Moffat protocol on Addgene (https://www.addgene.org/pooled-library/moffat-crispr-knockout-tkov3/) ...
-
bioRxiv - Biochemistry 2023Quote: ... Human DNMT3A1 and DNMT3L constructs were PCR amplified from cDNA expression constructs (Addgene #35521, #35523) and cloned by ligation dependant cloning into x6His-MBP-TEV or 6xHis-MBP-GFP expression vectors ...
-
bioRxiv - Neuroscience 2024Quote: ... the coding sequence of human tau isoform 0N4R was subcloned into the pJFRC7 vector (Addgene, plasmid #26220 ...
-
bioRxiv - Cancer Biology 2024Quote: The Human CRISPR Metabolic Gene Knockout library was a gift from David Sabatini (Addgene #110066)78 ...
-
bioRxiv - Cell Biology 2024Quote: Human Pcdhga9 mutants were generated by cloning PCR-amplified fragments into pBob-GFP vector (Addgene). For GFP-tagged constructs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... MoClo Plant Parts Kit (Addgene Kit #1000000047), GreenGate Cloning System (Addgene Kit #1000000036 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2×106 mEF-depleted cells were transfected with sgRNAs 2+3 and pCas9_GFP (a gift from Kiran Musunuru, Addgene #44719). To generate Chaserrb/b mESCs ...
-
bioRxiv - Neuroscience 2019Quote: Plasmids pNH13 (pmyo-2::QuasAr::mOrange) and pNH12 (pmyo-2::MacQ::mCitrine) were generated by subcloning of plasmids #59173 and #48762 (Addgene) into pPD132.102 (pmyo-2 ...
-
bioRxiv - Cell Biology 2021Quote: ... gonads of young adult BOX428 animals were microinjected with 30 ng/μl Pelt-2::αGFP-NB::ZIF-1 and 2.5 ng/μl Pmyo-2::GFP (#Addgene 26347) as a co-injection marker ...
-
bioRxiv - Neuroscience 2020Quote: ... AAV1.hSyn.GCaMP6f.WPRE.SV40 (120 nl, 2×1013 vg/mL Penn Vector Core/Addgene; diluted 1:2 to 1:10 in saline) was injected either into V1 ...
-
bioRxiv - Cancer Biology 2019Quote: ... A mixture of 3 transfection plasmids were produced by combining 2 µg pMDG.2 (Addgene #12259) (Addgene, Watertown, Massachusetts, USA); 4 µg of pCMV delta R8.2 (Addgene #12263 ...
-
bioRxiv - Microbiology 2022Quote: pCMV-GFP-SARS-CoV-ORF3a was generated by recombining the SARS-CoV-2-ORF3a coding sequence (pDONR207 SARS-CoV-2 ORF3aA, #141271, Addgene) into pDEST-CMV-N-EGFP (#122842 ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2-hSyn-mCherry (UNC vector core) (Figures 2, 6, & 7; Figure 2 – Figure supplement 1) or retrograde AAV-hSyn-DIO-eGFP (Addgene) and retrograde AAV-hSyn-mCherry (Addgene ...
-
bioRxiv - Microbiology 2022Quote: UAS-SARS-CoV-2-ORF3a transgenic flies were generated by PCR-mediated subcloning of the SARS-CoV-2-ORF3a coding sequence (pDONR207-SARS-CoV-2 ORF3a, #141271, Addgene) into pUASt-Attb (EcoRI/XbaI) ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Immunology 2023Quote: ... pDONR207 SARS-CoV-2 M and pDONR207 SARS-CoV-2 ORF3a (all plasmids were gifts from Fritz Roth via Addgene, # 141273 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μg of tdTomato-Mito-7 (Addgene #58115) (36 ...
-
bioRxiv - Immunology 2021Quote: pcDNA3.1-SARS-CoV-2 Spike (Addgene plasmid #145302) was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2 µg of psPAX2 (Addgene, #12260, MA, USA) and 2 µg of lentiCRISPRv2 sgRNA DMT1 ...
-
bioRxiv - Genetics 2020Quote: ... and pCFJ90 Pmyo-2-mCherry (Addgene plasmid 19327) and pCFJ104 Pmyo-3-mCherry (Addgene plasmid 19328)(Frøkjær-Jensen et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... and combined with pX330A-2-PITCh (Addgene #63670) by golden gate cloning ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD.2 (Didier Trono, Addgene plasmid # 12259), combined with either Cas9 expression vector plenti-Cas9-blast (Feng Zhang ...
-
bioRxiv - Molecular Biology 2023Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) was cut-out via Eco31I (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2023Quote: ... 2 µg of pCA-mTmG plasmid (#26123, Addgene) was added to diluted TAT-Cre and incubated at 37°C for 1 hour ...
-
bioRxiv - Microbiology 2023Quote: ... and pDONR223 SARS-CoV-2 spike (Addgene #149329) were subcloned into pLVpuro-CMV-N-3xFLAG (Addgene #123223 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-EF1a-DIO-hChR2-EYFP (1:2, Addgene viral prep # 20298- AAV9 ...
-
bioRxiv - Plant Biology 2023Quote: ... the AtCas9 (2×35S::AtCAS9-OCST; Addgene #112079) and the linker pICH41780 (Addgene #48019 ...
-
bioRxiv - Biophysics 2023Quote: The plasmid pr8ΔEnv.2 was obtained from Addgene, Plasmid #12263) ...
-
bioRxiv - Neuroscience 2024Quote: ... 85 nl of AAV1-hSyn:Cre (Addgene, 2 × 1013) was injected into vCA1 and 200 nl of a 1:1 cocktail of AAV9-pMeCP2:DIO-Cas9 (2 × 1012 GC/ml ...
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/2 (for AAV2; Addgene plasmid # 104963), pAAV2/5 (for AAV5 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PITCh sgRNA from pX330S-2-PITCh (Addgene #63670) vector was then inserted into the pX330A-1x2-cNAT10 vector using Golden Gate Assembly (New England Biolab ...
-
bioRxiv - Bioengineering 2024Quote: ... and exon 2-8 was cloned from Addgene #182141 ...
-
bioRxiv - Microbiology 2021Quote: ... 2 x 105 cells were seeded on 12-well plates and transiently transfected with 2 μg of plasmids encoding SARS-CoV-2 N (Addgene # 141391) or eGFP (Addgene # 141395 ...
-
bioRxiv - Neuroscience 2020Quote: A subsample of rats (n = 4, 2 males and 2 females) received bilateral retrograde AAV-CAG-TdTomato (59462-AAVrg; Addgene, MA) in mPFC (PL/IL ...
-
bioRxiv - Cancer Biology 2023Quote: ... AAACTCGGAGTTCTCAGAGCCCAGC NFKB2 guide #1 F: CACCGTGGCCCCTACCTGGTGATCG NFKB2 guide #1 R: AAACCGATCACCAGGTAGGGGCCAC NFKB2 guide #2 F: CACCGCTTTCGGCCCTTCTCACTGG NFKB2 guide #2 R: AAACCCAGTGAGAAGGGCCGAAAGC pLKO.TRC (Addgene; Cat#10878) was used for generating shNMNAT1 KD in U-87 MG and U-251 MG cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... pLVX-EF1a-SARS-CoV-2-nsp16-IRES-puro was generated by subcloning the nsp16 coding sequence from pDONR223 SARS-CoV-2 NSP16 (Addgene #141269) into pLVX-EF1a-IRES-puro empty vector ...
-
bioRxiv - Neuroscience 2023Quote: ... Male (N = 2) and female (N = 2) naïve mice were infused bilaterally with the anterograde tracer AAV8-Syn-mCherry (Addgene, Watertown, MA) in the CeA (0.2 µL) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were transfected with 250 ng of plasmids encoding the SARS-CoV-2 S genes delivered by pTwist-SARS-CoV-2 Δ18 D614G (Addgene, 164437) or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Immunology 2020Quote: Plasmids containing fluorescent protein coding sequences mCerulean3-N1 (Addgene # 54730), mAzurite-N1 (Addgene # 54617) ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp12 protein was expressed from pFastBac vector 438C (Addgene #154759) in Hi5 insect cells ...
-
bioRxiv - Systems Biology 2022Quote: ... Proteins were co-expressed with BirA (PET21a-BirA, Addgene #20857) in E ...
-
bioRxiv - Synthetic Biology 2020Quote: Expression vector encoding humanized pCas9_GFP protein was obtained from Addgene.org (Plasmid #44719) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Expression vectors encoding Anti-CRISPR proteins were obtained from Addgene: AcrIIA2 (pJH373 plasmid ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a green florescence protein (GFP) derived from pJL1 (Addgene #69496), and a C-terminal twin-strep-tag (66) ...
-
bioRxiv - Biochemistry 2021Quote: ... or N-terminal His6 plus green fluorescent protein (GFP; RRID:Addgene_29716). Note that in the plasmid names for this clone the numbering of Syx residues was based on the Syx isoform from NCBI Reference Sequence NP_001036128.1 ...
-
bioRxiv - Genetics 2020Quote: ... and a blue fluorescent protein (BFP) expression cassette (Addgene #36086). The 1kb upstream and 1kb downstream arms were amplified from purified mouse genome from AB2.2 ES cells (ATCC #SCRC-1023 ...