Labshake search
Citations for Addgene :
1 - 50 of 1063 citations for Human PDGF alpha receptor PDGFRA qPCR Primer Pair since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... we cloned pDONOR223-PDGFRA (Addgene 23892) and pDONOR223-PDGFRB (Addgene 23893 ...
-
bioRxiv - Developmental Biology 2020Quote: ... A plasmid containing estrogen receptor alpha (pEGFP-C1-ERα) was obtained from Michael Mancini (Addgene #28230) and mutated into a constitutively active form (pEGFP-C1-ERαY537S)29 using the Q5® Site-Directed Mutagenesis Kit (New England Biolabs ...
-
bioRxiv - Neuroscience 2021Quote: ... were infused bilaterally with AAV expressing the inhibitory designer receptor human M4 muscarinic receptor (hM4Di; AAV8-hSyn-hM4Di-mCherry, 4.8 × 1012 or 3.7 × 1012 vg/mL; Addgene; 0.3 μL) at a rate of 0.1 μL/min into the mOFC (AP ...
-
bioRxiv - Neuroscience 2022Quote: ... Gqi5 and mouse A1 receptor or human D2 receptor were established by transfecting CHO cells with pCAG-cyto-RCaMP (Addgene), pME-Gqi5 (Yamashiro et al*** ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049 ...
-
bioRxiv - Cancer Biology 2024Quote: ... harboring the full-length cDNA of human wild type Androgen receptor (AR) (Addgene plasmid # 89078 ...
-
bioRxiv - Neuroscience 2020Quote: ... amplified with a pair of primers: CCGCGAAGATCTATGAGTAAAGGAGAAGAACTTTTCAC and GGCAGTCGACCTGCAGCCGCGGCCGTTTGTATAGTTCATCCATGCCATG into pDisplay-mSA-EGFP-TM (Addgene plasmid #39863) (Lim et al. ...
-
ORAI1 establishes resistance to SARS-CoV-2 infection by regulating tonic type I interferon signalingbioRxiv - Microbiology 2021Quote: ... CACCGGATCGGCCAGAGTTACTCC; Reverse primer: AAACCGGAGTAACTCTGGCCGATCC) and human STIM1 (Forward primer: CACCGTGAGGATAAGCTCATCAGCG; Reverse Primer: AAACCGCTGATGAGCTTATCCTCAC) genes were subcloned into pLentiguide puro (Addgene). sgRNAs targeting human interferon alpha and beta receptor subunit 1 (IFNAR1 ...
-
bioRxiv - Bioengineering 2020Quote: ... VPR was amplified by primer pair VPR-F/R (template source: pWalium20-10XUAS-3XFLAG-dCas9-VPR (Addgene No.: # 78897)(Lin et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The NANOS3 gRNA expression cassettes driven by HU6 and ZU6 promoters were generated in the same manner using primer pair HU6(AgeI)_F and HU6_Nanos3gRNA(NheI)_R with gRNA_GFP-T2 (Addgene # 41820) plasmid as template DNA and primer ZU6_F1 and ZU6_Nanos3gRNA(NheI)_R with pDestTol2pA2-U6:gRNA (Addgene # 63157 ...
-
bioRxiv - Biochemistry 2024Quote: ... The cDNA of APLF full length and APLFΔFHA and APLFΔAD were amplified with respective primer pairs (Table S1) and subcloned into Flag-HA-pCDNA3.1 (Addgene #52535) (Horn et al. ...
-
bioRxiv - Microbiology 2023Quote: ... Human codon-optimized full-length Eph receptors were subcloned from pDONR223-EphB1 (Addgene # 23930 (82)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... a pair of single guide RNAs (sgRNA) targeting human TROP2 were inserted into lentiCRISPRv2 (Addgene, # 98293) and corresponding oligonucleotides were inserted into the pARv-RFP reporter vector (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: The knockdown plasmids for REST/NRSF and for the control GFP were constructed by ligating annealed primer pairs into the pLKO.1 vector (Addgene) between the EcoRI and AgeI sites ...
-
bioRxiv - Biochemistry 2021Quote: ... The PCR products were used as templates for final PCR using 5’ GGGGTACCGAA GTAAAACTTTAACTTCA G 3’ and 5’ CCGCTCGAGCTAATGATGATGATGATGATGC AATCCCCGAGACTTGTA C 3’ primer pair (KpnI and XhoI sites are underlined respectively) and cloned into pIB3 vector (cat # 25452, Addgene, USA). Similar strategy was used for PGAPDH-PEPCKDPRPEPCKMyc construct generation ...
-
bioRxiv - Plant Biology 2022Quote: ... AA106 and AA107) and mNeonGreen (primer pair: AA108 and AA109) were amplified from Zea mays B73 cDNA and mNeonGreen-2A-mTurquoise2 (Addgene #98885), respectively ...
-
bioRxiv - Plant Biology 2023Quote: ... we amplified a 10xHis-MBP coding fragment by PCR with primers pair 10xHis-MBP-F and 10xHis-MBP-R from pMAL-c2X® vector (Addgene), and cloned it into pTrcHis® vector (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: The human Insulin Receptor cDNA was a gift from Frederick Stanley (Addgene plasmid # 24049; http://n2t.net/addgene:24049; RRID:Addgene_24049). This construct (hIR ...
-
bioRxiv - Cell Biology 2022Quote: ... and Δ50 were PCR amplified from human templates using forward (fwd) primer 1593 and reverse (rev) primer 1651 and inserted into mycBioID2 pBabe puro (Addgene #80901) cut EcoRI to PmeI ...
-
bioRxiv - Cancer Biology 2024Quote: ... harboring the full-length cDNA of human wild type Androgen receptor (AR) (Addgene plasmid # 89078; http://n2t.net/addgene:89078; RRID: Addgene_89078) was procured from Addgene [17] ...
-
bioRxiv - Molecular Biology 2020Quote: ... 10ug pX458 2.0 plasmid pairs (Addgene) encoding Cas9 and sgRNAs were transfected using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Bioengineering 2020Quote: A pair of guide RNA targeting human EGFR was cloned into pSpCas9(BB)-2A-GFP (px458) plasmid vector (Addgene plasmid #48137) (Addgene ...
-
bioRxiv - Genetics 2024Quote: ... or the Alpha (Addgene # 170451), Beta (Addgene # 170449) ...
-
bioRxiv - Cell Biology 2023Quote: ... Expression vectors for mouse PDGFRα and PDGFRβ were generated from pcDNA5FRT-EF-Pdgfra-EGFPN (Addgene #66787) and pcDNA5FRT-EF-Pdgfrb-EGFPN (Addgene #66787) ...
-
bioRxiv - Cell Biology 2023Quote: The DNA fragment encoding human integrin β5 was amplified from the pCX-EGFP beta5 integrin receptor (a gift from Raymond Birge, Addgene #14996), and then inserted into the pEGFP-N1 vector (Clontech ...
-
bioRxiv - Developmental Biology 2023Quote: ... or EGFP-alpha-Tubulin (Addgene #56450) and grown 24 hr ...
-
bioRxiv - Molecular Biology 2024Quote: ... pEGFP-C1-ER alpha (Addgene: 28230) and pcDNA5-H2B_Halo_T2A_EGFP (Addgene:135444 ...
-
bioRxiv - Cell Biology 2024Quote: ... and a pair of TALENs (Addgene # 59025, # 59026) through co-electroporation into hPSCs ...
-
bioRxiv - Cell Biology 2024Quote: ... FKBP-alpha(740-977)-GFP (Addgene #100731); FKBP-GFP-Sec61β (Addgene #172442) ...
-
bioRxiv - Neuroscience 2023Quote: ... muscarinic receptor type 3/1 (CHRM3/1, Addgene) and GFP were co-expressed at a ratio of 8:4:3:1 ...
-
bioRxiv - Bioengineering 2024Quote: ... with receptor vectors originating in pHR_PGK (AddGene 79120) and reporter constructs cloned into pHR_Gal4UAS_PGK_mCherry (AddGene 79124) ...
-
bioRxiv - Microbiology 2020Quote: ... miniSOG-Alpha-V-Integrin-25 (Addgene plasmid # 57763)51 and Beta1-GFP in pHcgreen donated by Martin Humphries (Addgene plasmid # 69804)52 ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366 ...
-
bioRxiv - Neuroscience 2024Quote: ... we used pD454-SR mouse alpha-synuclein (Addgene plasmid ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... PDGF-TMD-GFP plasmid (pFU-no toxin-PE) was a gift from Ines Ibanez-Tallon (Addgene plasmid # 24149) 29.
-
bioRxiv - Physiology 2022Quote: ... HA-cholinergic M3 receptor cDNA was from Addgene (# 40753). BPTU (1-(2-(2-(tert-butyl)phenoxy)pyridin-3-yl)-3-(4-(trifluoromethoxy ...
-
bioRxiv - Neuroscience 2023Quote: ... FLAG-CDKL5 and dopamine D2 receptor (gfp-DRD2, Addgene) were co-transfected at a ratio of 2:0.75:1.
-
bioRxiv - Biophysics 2023Quote: The EGFP-alpha-synuclein gene was amplified from Addgene plasmid # 40822 (EGFP-alpha-synuclein-WT was a gift from David Rubinsztein (http://n2t.net/addgene:40822 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Relevant gRNA pairs were cloned into lentiCRISPR v2-Blast (Addgene #83480) and lentiCRISPR v2 (Addgene #52961 ...
-
bioRxiv - Molecular Biology 2024Quote: ... a 100 base pair fragment was amplified from pUC19 (#50005, Addgene) (Figure S1B ...
-
bioRxiv - Molecular Biology 2020Quote: ... and RPL22-3xHA (primers JG106/109; human cDNA template) with EcoRI/PstI digested pLV-TetO-hNGN2-P2A-eGFP-T2A-Puro (Addgene #79823) backbone ...
-
bioRxiv - Cell Biology 2022Quote: ... mCh-alpha-tubulin63 was a gift from Gia Voeltz (Addgene plasmid # 49149 ...
-
bioRxiv - Immunology 2024Quote: ... oligo pairs were annealed and cloned into the pLentiGuide-Puro (Addgene #52963). sgRNA inserts were confirmed by sequencing ...
-
bioRxiv - Bioengineering 2022Quote: ... a stimulatory G-protein coupled receptor (custom made Chemogenetics AAV: Addgene). Clozapine-N-oxide (CNO ...
-
bioRxiv - Immunology 2022Quote: ... for Alpha-S and pcDNA3.3-SARS2-B.1.617.2 (Addgene, no.172320) for Delta-S proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-ROCK2 was a gift from Alpha Yap (Addgene plasmid # 101296)(88) ...
-
bioRxiv - Cell Biology 2020Quote: GFP-mROCK2 was a gift from Alpha Yap (Addgene plasmid # 101296). 500 ng of plasmid DNA was transfected into 1×105 hTERT RPE-1 cells in DMEM/F12 medium containing 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2021Quote: The pIRESneo-EGFP-alpha Tubulin plasmid was obtained from Addgene (USA) and mutation (Y224G ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-Alpha-Actinin-19 (Addgene #54975, gift from Michael Davidson), pCMV-mApple-MyosinIIA-N-18 (Addgene #54930 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989, gift from Michael Davidson), pCMV-mCherry-Alpha-Actinin-19 (Addgene #54975 ...