Labshake search
Citations for Addgene :
251 - 300 of 10000+ citations for Human NID1 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... previously transfected with 500 ng of a human ACE2 expression plasmid (Addgene, Cambridge, MA, USA) were seeded at a density of 2 × 104 in 100 μL DMEM-10% in a white flat-bottomed 96-well plate one day prior to harvesting SARS-CoV-2 pps ...
-
bioRxiv - Microbiology 2023Quote: ... GFP or human c-MET cDNA were PCR amplified from plasmid pLenti-MetGFP (Addgene #37560) and seamlessly cloned into the BamHI/XbaI sites of vector pLenti-spCas9-Blast (Addgene #52962) ...
-
bioRxiv - Cell Biology 2023Quote: Coding sequence of human PITX2C (NM_000325.6) was cloned into lentivirus transfer plasmid (pWPI, Addgene#12254) using Gibson Assembly® kit (NEB ...
-
bioRxiv - Biophysics 2023Quote: Human BAF57 and BAF155 gene fragments were amplified from plasmids pBS-hBAF57 (Addgene ID #17877) and pBS-hBAF155 (Addgene ID #17876) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... Selected shRNAs were cloned into a modified lentiviral vector (Addgene #12247) using MluI and ClaI restriction sites ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA templates and shRNA oligoes mentioned above were acquired from Addgene or synthesized from BGI (Shenzhen ...
-
bioRxiv - Cancer Biology 2020Quote: shRNAs were subcloned into a Tet-on pLKO-puro (Addgene, #21915) via AgeI and EcoRI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: ... pBrain-GFP-shTACC3 shRNA was a gift from Stephen Royle (Addgene plasmid # 59355 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The shRNAs used were either purchased from Addgene (shCtrl: Addgene #1864) or designed using the Genetic Perturbation Platform.
-
bioRxiv - Immunology 2023Quote: ... The shRNAs were cloned separately into LentiCRISPRv2-GFP (modified from Addgene) and transiently co-transfected with psPAX2 (12260 ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA sequences were cloned into pSIH1-H1-puro vector (#26597; Addgene). cDNA sequences of PAK1 mutants with a C-terminus Flag tag were synthesized at BGI Genomics (Beijing ...
-
bioRxiv - Genomics 2020Quote: Human iPSCs were dissociated to single cells and nucleofected with Cas9-coding plasmid (hCas9, Addgene 41815), sgRNA plasmid and donor plasmid on Amaxa 4D-Nucleofactor program CA-137 (Lonza) ...
-
bioRxiv - Immunology 2021Quote: ... C domain coding sequences of human CRT were cloned into the pCMV vector (Addgene plasmid #59314) to generate recombinant constructs with C-terminal Human IgG1Fc (Ig ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plasmids containing the coding sequences of human SLC46A1 (pDONR221_SLC46A1) and SLC46A3 (pDONR221_SLC46A3) were purchased from Addgene. Custom plasmids (pTwist-CMV ...
-
bioRxiv - Neuroscience 2019Quote: ... ORFs from the human ORFeome collection were cloned into the pLEX307 destination plasmid (Addgene cat# 41392) using the standard LR clonase protocol (Thermo Fischer Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Corresponding oligonucleotides were annealed and cloned in the pX330 plasmid expressing human SpCas9 protein (Addgene #42230). The donor plasmids were constructed as follows ...
-
bioRxiv - Cancer Biology 2021Quote: Neonatal human dermal fibroblasts (HDFns) were transduced with lentiviruses containing pCHAC-mt-mKeima (Addgene plasmid #72342) (Lazarou et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... the human CAV1 fragment was further moved into a pET28-MBP-TEV plasmid (Addgene No. 69929) described in (37 ...
-
bioRxiv - Immunology 2021Quote: Full-length mouse and human NLRP3 were cloned into pLenti CMVie-IRES-BlastR (Addgene plasmid #119863). The resulting constructs were further modified by addition of N-terminal FLAG-tag followed by fluorescent protein mScarlet and Tobacco Etch Virus (TEV ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Cell Biology 2022Quote: Human PFKFB3 tagged with N-terminal GFP was cloned into the viral plasmid pWPXL (Addgene #12257). A PFKFB3 mutant (nuc-free PFKFB3 ...
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid pET-TRSter for heterologous expression of human thioredoxin reductase (hTrxR) was purchased from Addgene. Plasmids for wt and mutant DJ-1 were obtained from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... N-terminal HA-tagged full-length pCGN-ATF6-N plasmid came from Addgene (catalog #: 11974, human). The XBP1s plasmid was a kind gift from Dr ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293T cells were transfected with plasmid pLXSN16E6E7 encoding the human papilloma virus HPVE6E7 gene (Addgene #52394) as described [18] ...
-
bioRxiv - Cell Biology 2023Quote: ... human ATAD1 was amplified from HEK293T cDNA and cloned into the pKH3 vector (Addgene plasmid #12555). The ATAD1 Walker B mutation (ATAD1E193Q ...
-
bioRxiv - Cell Biology 2020Quote: ... MKL1/2 shRNA construct was obtained from Addgene (Lee et al., 2010). CAG:GFP construct was obtained from Cellomics Technology (PLV10057) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Nontargeting shRNA in pLKO.1 (shSCR) was used as a control (Addgene). For sgRNA experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... Control Scramble shRNA sequence (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) was the same as that from Addgene Plasmid # 1864.
-
bioRxiv - Neuroscience 2021Quote: ... the AAV-shRNA-ctrl was a gift from Hongjun Song (RRID: Addgene_85741) (Yu et al. ...
-
bioRxiv - Systems Biology 2023Quote: ... Control shRNAs targeting luciferase or GFP were previously described (Addgene #83092, #83085) 33.
-
bioRxiv - Neuroscience 2023Quote: ... RSPO2 shRNAs were cloned into the pLentiLox 3.7 lentiviral vector (PLL3.7, AddGene), which co-expresses green fluorescent protein (GFP) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The backbone vector for shRNAs was purchased from Addgene (pLKO.1_mCherry, 128073). We followed the shRNA construction protocol from the Genetic Perturbation Platform web portal (https://portals.broadinstitute.org/gpp/public/resources/protocols) ...
-
bioRxiv - Immunology 2021Quote: ... the human CRISPR 2-plasmid activation pooled library (SAM) was a gift from Feng Zhang (Addgene #1000000078) and used for CRISPR activation screening ...
-
bioRxiv - Cancer Biology 2019Quote: ... For CRISPR-mediated homologous recombination the human codon-optimized Cas9 expression plasmid was obtained from Addgene (41815). The sgRNA-GFP plasmid was obtained from Addgene (41819 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454 and Addgene plasmid #8455 ...
-
bioRxiv - Biochemistry 2022Quote: Human Drp1 (Uniprot ID: O00429-4) with a C-terminal StrepII tag in pET15b (Addgene plasmid #174428) was expressed in BL21(DE3 ...
-
bioRxiv - Cell Biology 2021Quote: ... hLamp1-BFP (#1016) plasmid encoding BFP-labeled version of human Lamp1 protein was from Addgene (Cat# 98828). GFP-hRab14.dn3 (#1017) ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmid encoding a mCherry-labeled dominant negative mutant version of human Rab5A was from Addgene (Cat# 35139). GFP-hRab5B.dn3 (#1008 ...
-
bioRxiv - Bioengineering 2020Quote: ... we used the human codon optimized Cas9 from lentiCRISPR v2 plasmid (Addgene 52961, Sanjana et al., 2014) as background for xCas9 and Cas9-NG mutations ...
-
bioRxiv - Neuroscience 2019Quote: Myc-Par3 was created by subcloning human myc-Par3 from the pK-myc-Par3b plasmid (Addgene #19388) into the peGFP-N2 vector as described above using BamHI and NotI restriction sites ...
-
bioRxiv - Cell Biology 2020Quote: Human Rab21 (aa 16-225) constructs were cloned into a Gateway destination vector pgLAP1 (Addgene plasmid #19702) to express Rab21 with an N-terminal GFP followed by a TEV cleavage site and an S-Tag in mammalian cells ...
-
bioRxiv - Biochemistry 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Pooled Library #1000000048),pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene plasmid # 42230), and lentiCRISPR v2 (Addgene plasmid # 52961 ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Immunology 2022Quote: ... pEGFP-LC3 (human) was a kind gift from Toren Finkel (Lee et al., 2008) (Addgene plasmid # 24920).
-
bioRxiv - Biochemistry 2023Quote: A pProEx-IDE-wt (#99014) plasmid containing cloned human IDE (Met42–Leu1019) was purchased from Addgene (UK). The plasmid encoded a 6-histidine tag at the N-terminus of the protein ...
-
bioRxiv - Neuroscience 2023Quote: Plasmid containing iGluSnFR(A184S) under the control of the human synapsin promoter was purchased from Addgene (#106174) and packaged in the AAV8-Y733F serotype 55 ...
-
bioRxiv - Biophysics 2023Quote: A plasmid encoding the GST-tagged human afadin PDZ domain was a gift from Sachdev Sidhu (Addgene plasmid # 103938 ...
-
bioRxiv - Immunology 2023Quote: ... Variable regions were cloned into pVITRO1 plasmids that already contained the constant regions for human IgG1 heavy and light chains (κ or λ, Addgene plasmids #61883 and #50366)85 using Gibson Assembly75 ...