Labshake search
Citations for Addgene :
151 - 200 of 2238 citations for Human Mitochondrial Genome Maintenance Exonuclease 1 MGME1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: Retroviral pLPCX vectors expressing the mitochondrial or cytoplasmic form of Grx1-roGFP227 and roGFP2-ORP123 were obtained from Addgene (Addgene, Watertwon, CA, USA) and used to transduce FL5.12MycER cells ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Molecular Biology 2021Quote: ... pAc5.1C-FLuc-Stop-5BoxB was a gift from Elisa Izaurralde (Addgene plasmid # 21301)30 ...
-
Dorsal raphe dopamine neurons signal motivational salience dependent on internal and external statesbioRxiv - Neuroscience 2020Quote: ... encoding jGCaMP7f or GCaMP6m in a cre-dependent manner (diluted to 1.0 × 1013 genome copies/mL, both from Addgene) were injected to the DRN (antero-posterior axis −4.7 mm ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells were transduced overnight at a MOI of 0.4 with a pooled genome-wide CRISPR KO (GeCKO v2) library A or B (Addgene) containing a total of 122,411 sgRNAs (6 sgRNAs per gene ...
-
bioRxiv - Immunology 2020Quote: ... A plasmid library of sgRNAs targeting all protein coding genes in the mouse genome (Brie Knockout library, Addgene 73633) was packaged into lentivirus using HEK293T cells ...
-
bioRxiv - Genomics 2022Quote: ... we utilized CRIPR/Cas9 genome editing system with single guide RNAs (sgRNAs) cloned into SpCas9 px330 plasmid (Addgene, #98750). Three px330-mCherry-sgRNAs vectors were co-transfected into H3.1 and H3.3 sensor cell lines using TransIT-X2 Transfection Reagent (Mirus Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV2-hSyn-DIO-EGFP retrograde virus construct (7.6×1012 genome copies/ml; 50457-AAVrg, Addgene, Watertown, MA, USA) was made with a flow rate of 1.0 µl/min ...
-
bioRxiv - Neuroscience 2022Quote: ... were injected with a virus for EYFP (AAV5-EF1a-DIO-EYFP-WPRE-hGHpA, Addgene, titer: 2E13 genome copies/mL) or received no injection ...
-
bioRxiv - Synthetic Biology 2022Quote: The de novo sequencing and genome assembly of Syn61Δ3(ev5) (from a single-colony isolate of Addgene strain #174514) was performed by generating 84,136 Oxford Nanopore (ONT ...
-
bioRxiv - Cell Biology 2023Quote: Whole-genome CRISPR screens were performed in U2OS and U2OSp53KO cells using the GeCKOv2 two-vector system (Addgene, #1000000049). The two pooled DNA half-libraries (A and B ...
-
bioRxiv - Cancer Biology 2023Quote: The Brunello genome-wide gRNA library contains 76,441 gRNAs targeting 19,114 genes and was obtained from Addgene (Cat# 73178). Lentivirus containing the Brunello library was generated and used to transduce NB4 cells ...
-
bioRxiv - Neuroscience 2023Quote: ... HEK-293T cells were transfected with the respective genome library along with helper plasmids pCAG-B19N (Addgene cat. # 59924), pCAG-B19P (Addgene cat ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Cell Biology 2020Quote: ... An S288C nup116ΔGLFG strain was generated by cloning the nup116ΔGLFG genome sequence from SWY2791 into SnaBI- and XhoI-digested pAG306-GPD-empty chr I (Addgene 41895) using Gibson Assembly master mix (NEB E2611L) ...
-
bioRxiv - Neuroscience 2020Quote: Optogenetic transduction of neurons was achieved using AAV9-CaMKii-hChR2(E123T/T159C)-mCherry (Addgene 35512; 3.3 × 1013 genome copies/ml) obtained from University of Pennsylvania Vector Core or Addgene ...
-
bioRxiv - Microbiology 2021Quote: The genome-scale CRISPR-Cas9 screen was performed using the mouse GeCKOv2 sgRNA library as previously described (Fig. 1A) (Addgene) [36] ...
-
bioRxiv - Neuroscience 2022Quote: ... opsin construct), >1.3×1013 vector genomes/ml (Neuroscience Center Zurich, control construct) and 1.4 × 1013 GC/mL (Addgene, opsin construct). The viral vectors were aliquoted and stored at -80°C until stereotaxic injection surgeries.
-
bioRxiv - Systems Biology 2020Quote: ... coli K-12 MG1655 Δcrp genome was done using a two-step recombination method using pSLTS plasmid (Addgene plasmid #59386). The primers used in this method are given in Supplementary Table S2 ...
-
bioRxiv - Immunology 2021Quote: The lentiviral gRNA plasmid library for genome-wide CRISPR-Cas9 screen (Mouse Improved Genome-wide Knockout CRISPR Library v2, Pooled Library #67988#) and mock vector (#67974) was obtained from Addgene. The library was amplified following the protocol provided by Addgene ...
-
bioRxiv - Genetics 2020Quote: Genome-wide CRISPR-Cas9 screening was performed using pre-made Brunello21 lentivirus in the CRISPR-v2 backbone (Addgene 73179-LV). HT-29 cells were plated in two replicates at a concentration of 4∗10^4/cm2 in 25-cm2 plates with 8 ug/mL of polybrene for lentivirus infection ...
-
bioRxiv - Microbiology 2020Quote: ... 1.5 x 108 Huh7 cells for each of two replicates were transduced at a MOI of ~0.3 with lentivirus containing the Brunello genome-wide library in lentiCRISPRv2 (Addgene 73179), which contains 77.441 sgRNAs targeting 19.114 genes ...
-
bioRxiv - Cell Biology 2021Quote: ... All the plasmids for Genome-wide CRISPR library generation (GeCKOv2) and individual gene knockouts were procured from Addgene (MA, USA). CellLight Tubulin-RFP / GFP ...
-
bioRxiv - Neuroscience 2022Quote: ... using an ultra-fine dental drill and inserted a glass pipette backfilled with AAV2-CamkIIa-hChR2(H134R)-EYFP (titer: 3×10¹² viral genomes per ml, 26969-AAV2, Addgene). AC was approached similar to extracellular recordings ...
-
bioRxiv - Neuroscience 2023Quote: EnvA-enveloped ΔGL rabies viruses were rescued in 15 cm plates as described23 using genome plasmids pRVΔGL-4Flpo (Addgene 98040) and pRVΔGL-4Cre (Addgene 98039) ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Cell Biology 2020Quote: Approximately 300 × 106 IAPEz reporter cells expressing Cas9 were lentivirally infected with a genome-wide Mouse Two Plasmid Activity-Optimized CRISPR Knockout Library (Addgene #1000000096) as described above ...
-
bioRxiv - Neuroscience 2021Quote: ... We applied our system to the SAD-B19 genome plasmid in which the G gene has been replaced by EGFP (cSPBN-4GFP, Addgene #5248715), targeting the barcode cassette to the 3’ UTR of EGFP adjacent to the viral polyadenylation sequence53 ...
-
bioRxiv - Neuroscience 2021Quote: ... The donor was made by amplifying homology arms from the genome by PCR and fusing them by Gibson assembly with a cDNA coding for 6xHis-mClover3 (Addgene #74252) (Bajar et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... HEK 293T cells (ATCC CRL-11268) were transfected with expression vectors for the ribozyme-flanked viral genome (cSPBN-4GFP (Addgene 52487) or pRVΔG-4tdTomato (Addgene 52500)) ...
-
bioRxiv - Cell Biology 2022Quote: HEK293T cells were used to generate lentiviral particles by transient transfection of lentiviral constructs (SLC-SAM library or genome-wide SAM library addgene #1000000057) and packaging plasmids psPAX2 (Addgene #12260), pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2021Quote: Lig4-/- or Lig4-/-:Lin37-/- abl pre-B cells were transduced with lentiviral mouse genome-wide CRISPR gRNA library V2 (Addgene #67988) by centrifuging a cell and viral supernatant mixture (supplemented with 5μg/ml polybrene ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV8-EF1a-DIO-H2B-GFP-2A-OG (10min, 1.54 × 1013 genome units per ml, custom packaged by Vigene Biosciences, Addgene plasmid #74289) was delivered through iontophoresis into target subregions in double transgenic mice of CaMKIIα-Cre ...
-
bioRxiv - Neuroscience 2022Quote: ... The reference was generated from the mouse genome (GRCm38) and annotation (GRCm38.93) and modified to include the sequences for tdTomato (Addgene plasmid # 22799) (Madisen et al. ...
-
bioRxiv - Developmental Biology 2023Quote: Donor Plasmids for insertion of 5xtetO-pEF1-H2B-CITRINE reporter into the genome were constructed by subcloning 5xtetO-pEF1-H2B-CITRINE-PolyA from PhiC31-Neo-ins-5xtetO-pEF-H2B-Citrine-ins (Addgene# 78099)14 with right and left homology arms (500 bps each ...
-
bioRxiv - Genetics 2023Quote: The gRNA library used for the screening was the Mouse Improved Genome-wide Knockout CRISPR Library v2 (a gift from Kosuke Yusa, Addgene, #67988) (48) ...
-
bioRxiv - Genomics 2023Quote: sgRNAs targeting 3 different locations in the genome were cloned into a modified version of pU6-sgRNA EF1Alpha-puro-T2A-BFP (Addgene, #60955), where BFP was replaced by superfolder GFP (sfGFP ...
-
bioRxiv - Neuroscience 2023Quote: The lentiviral vector LV-TTBL(VSVG) was made as described (Wickersham et al., 2015) using the genome plasmid pLV-TTBL (Jin et al., 2021) (Addgene 115233) and using the VSV envelope expression plasmid pMD2.G (Addgene 12259 ...