Labshake search
Citations for Addgene :
151 - 200 of 10000+ citations for Human METTL3 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... NT#3-TTGGATGGGAAGTTCACCCCG) or IP3R1-targeting shRNA (ULTRA3316782- TTTCTTGATCACTTCCACCAG) were packaged as lentiviral particles using packaging (pCMV- dR8.2 dpvr, Addgene, plasmid #8455) and envelope vectors (pCMV-VSV-G ...
-
bioRxiv - Cancer Biology 2024Quote: ... ALKBH5 shRNA was generated by ligation of oligonucleotides into the AgeI and EcoRI restriction sites of pLKO.1 (Addgene plasmid #8453). Lentiviral-shRNA particles were generated by transfecting HEK 293T cells with 12 μg of pLJM1 vector containing the shRNA ...
-
bioRxiv - Biochemistry 2022Quote: A pET28a plasmid containing full-length human β-catenin was gifted from Randall Moon (Addgene plasmid # 17198) and various fragments of the coding region (residues 1-137 (NTERM) ...
-
bioRxiv - Molecular Biology 2019Quote: ... The donor plasmid pAAVS1-TRE3G-NGN2 was constructed by replacing EGFP with human NGN2 in plasmid AAVS1-TRE3G-EGFP (Addgene plasmid # 52343). The donor plasmid pAAVS1-TRE3G-NGN2 (5 μg) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The human TLR4 overexpression plasmid was purchased from Addgene (Cat. #13086). The T695A and T656A mutations were generated in WT-YME1L1 plasmid via QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmids encoding wild-type human RAB11 (#12679) was obtained from Addgene. The following primer sets were used for site directed mutagenesis:
-
bioRxiv - Cell Biology 2021Quote: ... The following plasmids were used: pEGFP-N1 human cofilin (Addgene 50859) and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Cell Biology 2020Quote: Human WT CXCR4 was acquired as a donor plasmid (#81957, Addgene) and recombined into a lentiviral destination vector (#25890 ...
-
bioRxiv - Genomics 2022Quote: Human STARR-seq-ORI vector was obtained from Addgene (plasmid #99296). 8ug of STARR-seq plasmid was digested with 20uL AgeI-HF® (R3552 ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Immunology 2019Quote: ... Human codon optimized cas9 DNA was obtained from (Addgene, Plasmid #41815). To generate the knockout cell lines ...
-
bioRxiv - Microbiology 2023Quote: Human TREX1 sequences were derived from plasmid GFP-TREX1 (Addgene 27219) and TREX1-D18N (Addgene 27220).
-
bioRxiv - Cell Biology 2023Quote: Plasmid containing CDS sequences of human MCU were taken from Addgene and restriction digestion was performed ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human DNMT1 plasmid was purchased from Addgene (#36939, Watertown, MA, USA) (Li et al. ...
-
bioRxiv - Cancer Biology 2023Quote: Human GBM cells were transduced with the 7TGC (Addgene plasmid #24304), 7TGC-SFRP1 or 7TGC-Notum lentiviral vectors at a multiplicity of infection (MOI ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... Scramble shRNA pLKO.1 vector (Addgene, 1864) was used as a control.
-
bioRxiv - Molecular Biology 2022Quote: ... Nontargeting shRNA control was purchased from Addgene. Single siRNA duplex sequences targeting C1orf112 ...
-
bioRxiv - Physiology 2019Quote: ... Vectors were sourced from OriGene (Rockville, MD) for PISD-expressing plasmid (MR206380), Sigma (St. Louis, MO) for shRNA for mouse PISD (shPSD: TRCN0000115415, and Addgene (Cambridge, MA) for psPAX2 (ID #12260) ...
-
bioRxiv - Bioengineering 2021Quote: RNA Mango control and EXO-Probe gene fragments were synthesized (IDT) and cloned into the shRNA-expressing plasmid vector pSLQ1615 (Addgene, Watertown, MA). Plasmids were transformed into E ...
-
bioRxiv - Cancer Biology 2023Quote: ... and SNAI1 knockdown cells were generated by cloning respective shRNA sequences into the 3rd generation lentiviral plasmid pLKO.1 TRC cloning vector (Addgene, cat# 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid expressing the human ACE2 protein with a C-terminal C9 tag was obtained from Addgene (Plasmid 1786). 293T cells were transduced with retroviral particles carrying a pQCXIP vector encoding the gene for the human ACE2 protein ...
-
bioRxiv - Developmental Biology 2019Quote: ... The pcDNA3-HA-human OCRL plasmid was a gift from Pietro De Camilli (Addgene plasmid # 22207; http://n2t.net/addgene:22207; RRID:Addgene_22207).
-
bioRxiv - Biochemistry 2022Quote: ... The plasmid expressing FLAG-tagged wild-type human HDAC1 was a gift from Eric Verdin (Addgene Plasmid # 13820). HCT116 cells were transfected in 10 cm plates with 8 μg plasmid and 40 μl PEI ...
-
bioRxiv - Molecular Biology 2019Quote: ... Complemention of timeless was achieved by transfection of plasmids encoding the human Timeless WT cDNA (Addgene plasmid 22887), or truncated versions thereof ...
-
bioRxiv - Cell Biology 2020Quote: ... pEGFP-LC3 (human) plasmid construct was purchased from Addgene (catalog number 24920). All mutant ATG9a ...
-
bioRxiv - Cell Biology 2020Quote: Human SAR1 was subcloned into pLenti-puro (Addgene Cambridge, MA; Plasmid #39481). The plasmid containing SAR1 was transfected with Lipofectamine 2000 (Invitrogen ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... pcDNA3-HA-human OCRL (gift from Pietro De Camilli, Addgene plasmid # 22207); pCDNA3.0_mitoLAMA-G97 (gift from Kai Johnsson ...
-
bioRxiv - Cell Biology 2019Quote: Human STAMBPL1 was PCR amplified from FLAG-HA-STAMBPL1 (Addgene plasmid #22559), human TBC1 domain containing kinase (TBCK ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Microbiology 2020Quote: ... The pmCherry-human vinculin (HV) and pmCherry-VASP plasmids were from Addgene. Stealth siRNA anti-human vinculin was from Invitrogen (reference number 1299001) ...
-
bioRxiv - Immunology 2021Quote: Plasmid encoding human ACE2 (hACE2) was obtained from Addgene (hACE2; catalog #1786). The hACE2 2.6 kbp ORF was also blunt-cloned into a third generation HIV vector 3’ of CMV promoter and 5’ of an IRES- puror cassette to generate pHIV-CMV-hACE2-IRES-Puro ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human EGFRvIII expression was induced using pMSCV-XZ066-EGFRvIII (Addgene, plasmid 20737) and murine hEGFRvIII+ B-ALL cells were generated ...
-
bioRxiv - Neuroscience 2022Quote: ... pEGFP-LC3 (human) was a gift from Toren Finkel (Addgene, Plasmid #24920). pMXs GFP-LC3-RFP was a gift from Noboru Mizushima (Addgene ...
-
bioRxiv - Microbiology 2022Quote: ... The human codon-optimized T7 polymerase plasmid was obtained from Addgene (#65974) and the CVB3 infectious clones encoding mCherry (CVB3-mCherry ...
-
bioRxiv - Cell Biology 2024Quote: Transfection experiments were done with human WT PCMVHA hEZH2 plasmid (#24230, Addgene), a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2023Quote: ... shRNA 2 (shYAP1 #2) or scramble shRNA (shNC) were inserted into pLKO.1-TRC Cloning Vector (Addgene, 10878, RRID: Addgene_10878) following the manufacturer’s protocol and sequenced ...
-
bioRxiv - Cancer Biology 2019Quote: CXCR4 shRNA Sequence: 5’CCGGTCCTGTCCTGCTATTGCATTACTCGAGTAATGCAATAGCAGGACAGGATTTTTG 3’ was cloned into the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat no. 10878) between unique AgeI and EcoRI sites downstream of the U6 promoter ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human cells used for RNA sequencing were first integrated with Not1-linearized pBABE-neo-hTERT plasmid (Addgene plasmid # 1774) and selected with G418 ...
-
bioRxiv - Immunology 2019Quote: ... The sgRNA oligos were annealed and ligated into the human codon-optimized SpCas9 expression plasmid (pX330; Addgene plasmid # 42230), as described previously63 ...
-
bioRxiv - Microbiology 2023Quote: ... A no-template preparation (negative control) and a plasmid encoding egfp (positive control, pClneoEGFP human RASSF6b, Addgene plasmid #37021), along with non-transduced EBECs and HBECs were included ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin ...
-
bioRxiv - Cancer Biology 2022Quote: ... EVI1 shRNAs were cloned into pLKO2Tetpuro (Addgene #21915) sh1 (TGCAGGGTCACTCATCTAAAG) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pSUPER-retro-puro-GFP shRNA (Addgene #30519).
-
bioRxiv - Molecular Biology 2022Quote: ... we inserted shRNA sequences into pLKO.1 (Addgene) or shmirRNA (Addgene ...
-
bioRxiv - Cancer Biology 2023Quote: shRNA against β-catenin was purchased from Addgene (pLKO.1 puro shβ-catenin ...
-
bioRxiv - Biochemistry 2021Quote: ... shRNA targeting mSARM1 (5’-CCGGCTGGTTTCTTACTCTACGAATCTCGAGATTCGTAGAGTAAGAAACCAGTTTTTG-3’) or the scrambled shRNA (5’-CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTTG-3’) were inserted to pLKO.1-puro (Addgene, #8453) with EcoRI and AgeI ...
-
bioRxiv - Molecular Biology 2021Quote: ... and YTHDC1 were generated by cloning the shRNA (RNAi Consortium shRNA Library) from pLKO.1-puro into the pLKO.1-blast backbone (Addgene #26655).
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...