Labshake search
Citations for Addgene :
351 - 400 of 2774 citations for Human Immunodeficiency Virus GP41 Protein HIV 1 Clade B IIIB since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... we drilled a small hole in the skull and injected ??nl of an AAV virus pAAV.Syn.GCaMP6f.WPRE.SV40 (AAV9; from Addgene) using a glass pipette ...
-
bioRxiv - Neuroscience 2020Quote: ... The virus pZac2.1 gfaABC1D-cyto-GCaMP6f was a gift from Baljit Khakh (Addgene plasmid cat.# 52925). Viral infections were performed at upto 20×109 viral particles as final concentration in 200µL volume per well ...
-
bioRxiv - Neuroscience 2019Quote: ... AAV5 CaMKII-hM3Dq-IRES-mCitrine (3.75×10^14 or 3.75×10^13 virus molecules/mL) (Addgene plasmid #50466 ...
-
bioRxiv - Neuroscience 2022Quote: We injected bilaterally 600μL channelrhodopsin-infused retrograde adeno associated virus pAAV-Syn-ChR2(H134R)-GFP (Addgene) in ventral hippocampus (A/P ...
-
bioRxiv - Neuroscience 2022Quote: ... We then used adeno-associated virus AAV1 carrying the construct GCaMP6s under the CaMKIIα promoter (Addgene# 107790-AAV9 ...
-
bioRxiv - Physiology 2022Quote: ... The control virus AAV2/5-hSyn-DIOmCherry was ordered from Penn Vector Core (Addgene plasmid 50459). Animals were allowed to recover from stereotaxic surgery for a minimum of 21 days before initiation of any experiments ...
-
bioRxiv - Neuroscience 2023Quote: ... we infected 4 DIV neurons with adeno-associated virus (AAV) expressing CamK2a-Cre (Addgene# 105558-AAV1) - pENN.AAV.CamKII 0.4.Cre.SV40 was a gift from James M ...
-
bioRxiv - Neuroscience 2023Quote: ... 150-200nl of Cre- and Flp-dependent virus AAV8-hSyn-Con/Fon-EYFP (Addgene #55650-AAV8) was unilaterally injected into the MPN (AP 0 ...
-
bioRxiv - Neuroscience 2023Quote: ... all mice received injections of a hM3Dq virus (pAAV-S5E2-Gq-P2A-dTomato; Addgene #135635-AAV1)58.
-
bioRxiv - Neuroscience 2023Quote: ... unilateral injections of a virus designed to Cre-dependently express GCaMP6s (AAV1.Syn.Flex.GCaMP6s.WPRE.SV40, Addgene, 100845-AAV1) were performed in the arcuate nucleus of the hypothalamus (ARC ...
-
bioRxiv - Neuroscience 2023Quote: ... with the rabies virus genomic vectors that contained either mCherry (pSADdeltaG-F3-mcherry, Addgene plasmid #32634), or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-week-old Vglut2-Cre mice were injected with pAAV-EF1a-DIO-tdTomato-WPRE virus (RRID:Addgene_133786 ...
-
bioRxiv - Neuroscience 2024Quote: ... we obtained the AAV2/5 virus of the GFAP -tdTomato vector from Addgene (#44332-AAV2/5). Titers ranged from 1-4 x 1013 vg/mL.
-
bioRxiv - Immunology 2022Quote: ... pTwist-SARS-CoV-2 Δ18 B.1.351v1 (Addgene, no.169462) for Beta-S protein was a gift from Alejandro Balazs26 ...
-
bioRxiv - Neuroscience 2022Quote: ... pZac2.1-GfaABC1D-mCherry-hPMCA2w/b plasmid was ordered from Addgene.
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907) or a pTwist empty vector (250 ng ...
-
bioRxiv - Microbiology 2023Quote: ... or pTwist-SARS-CoV-2 Δ18 B.1.1.529 (Addgene, 179907), incubated overnight at 37°C with 5% CO2 and fixed with 3.7% PFA for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... Ras GTPase-activating protein-binding protein 1 (G3BP1) phage UbiC G3BP1-GFP-GFP was a gift from Jeffrey Chao (Addgene plasmid # 119950 ...
-
bioRxiv - Immunology 2023Quote: Pseudovirus expressing Wuhan-Hu-1 SARS-CoV-2 S protein were produced by co-transfection of plasmids encoding a GFP protein (Addgene, 11619), a lentivirus backbone (VRC5602 ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Cell Biology 2021Quote: ... this cell line was co-transfected with a 9:1 ratio of pCENP-B-Cherry (a gift from Michael Lampson; Addgene plasmid #45219) and pPGKpuro resistance plasmid ...
-
bioRxiv - Cell Biology 2023Quote: ... two shRNAs targeting EZH2 (shEZH2-a: CCGGCCCAACATAGATGGACCAAATCTCGAGATTTGGTCCATCTATGTTGGGTTTTT G and shEZH2-b: CCGG CGGAAATCTTAAACCAAGAATCTCGAGATTCTTGGTTTAA GA TTTCCG TTTTTG) were designed and cloned into pLKO.1 vector (Addgene plasmid #10879) according to method by Moffat ...
-
bioRxiv - Neuroscience 2021Quote: ... Univ of Pennsylvania) (Herman et al. 2016) and CaMKII-Cre virus (pENN-AAV9-CaMKII-Cre-SV40; Addgene, Watertown ...
-
bioRxiv - Neuroscience 2021Quote: ... was loaded with the GCaMP6s virus (AAV9.Syn1.GCaMP6s.WPRE.SV40, ≈1.9x1013 GC/ml, Penn Vector Core; RRID: Addgene_100843) and was slowly lowered into VTA (DV -8.1 mm relative to brain surface) ...
-
bioRxiv - Neuroscience 2022Quote: ... Circuit-specific viral expression was achieved using the retrograde properties of adeno-associated virus (AAV) serotype 5 23: AAV5.hSyn.HI.eGFP-Cre.WPRE.SV40 (Addgene; #105540). Sparse labelling was obtained using Cre-inducible ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM3D(Gq)-mCherry (Addgene viral prep # 50476-AAV8, Addgene, Cambridge, MA). In the GFP (null virus ...
-
bioRxiv - Neuroscience 2020Quote: ... the virus used was AAV8-CaMKIIα-hM4D(Gi)-mCherry (Addgene viral prep # 50477-AAV8, Addgene, Cambridge, MA). In the Gq experiment ...
-
bioRxiv - Molecular Biology 2020Quote: ... These cells were spin transfected for 2h at 1000g with 82*10E6 Brunello virus particles (LentiCRISPRv2, Addgene 73179-LV ...
-
bioRxiv - Neuroscience 2020Quote: A retrogradely-transported adeno-associated virus carrying Cre recombinase (AAV pmSyn1-EBPF-Cre, abbreviated retro-Cre; Addgene viral prep #51507-AAVrg ...
-
bioRxiv - Physiology 2021Quote: ... Cre-positive mice received the AAV-hM4D injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2020Quote: ... we injected ∼0.5 μl of retrograde adeno-associated virus expressing tdTomato51 (retroAAV-tdTomato, Addgene Cat# 59462-AAVrg) into the right ACC (bregma +1.2 mm ...
-
bioRxiv - Neuroscience 2020Quote: All optogenetic behavioral manipulations were conducted with bilateral virus injections of AAV2-hSyn-ChR2-EYFP (500nL, Addgene) into either ALM (AP 2.90 ...
-
bioRxiv - Neuroscience 2022Quote: ... we infected the neurons with the retrograde virus pGP-AAVrg-syn-jGCaMP7s-WPRE (Addgene, Plasmid #104487-AAVrg). Injections (450 μL ...
-
bioRxiv - Neuroscience 2022Quote: ... A small volume (0.4 μl total) of virus (AAV8-EF1α-CreOn/FlpOn-GCaMP6f (RRID:Addgene_137122, titer 6.10E+13) for Aldh1a1-iCre/Th-Flpo and VGlut2-IRES-Cre/Th-Flpo mice ...
-
bioRxiv - Neuroscience 2022Quote: ... Cre-positive mice received the AAV-ChR2 injection (test mice) or a control virus AAV-YFP (Addgene) (control mice) ...
-
bioRxiv - Neuroscience 2022Quote: Tobfl/fl mice were bilaterally injected with Cre-expressing adeno-associated virus AAV1.hSyn.Cre.WPRE.hGH (105553-AAV1, Addgene) to generate hippocampus-specific KO mice ...
-
bioRxiv - Genomics 2022Quote: ... Wild-type (J1) mESCs were transduced with Cas9-blast virus (generated from pLentiCas9-Blast, Addgene ID: 52962) and selected with 10μg/ml blasticidin (InvivoGen ...
-
bioRxiv - Neuroscience 2022Quote: ... DAT-IRES-Cre mice (RRID: IMSR_JAX:027178) were injected with AAV1-CAG-FLEX-GCaMP6f virus (RRID: Addgene_100835). For labelling of SNc Anxa1+ neurons ...
-
bioRxiv - Cell Biology 2023Quote: ... Virus was generated in HEK293T cells by transfection with the aforementioned transfer vectors and pMDLg (Addgene 12251), pRSV-REV (Addgene 12253) ...
-
bioRxiv - Neuroscience 2023Quote: ... or a control virus (AAV2-hSyn-DIO-EGFP, 100 µL at titer ≥ 3×10¹² vg/mL, Addgene). A subset of the optogenetic L6-CT experiments was done in Ntsr1-Cre-ChR2-EYFP mice ...
-
bioRxiv - Neuroscience 2023Quote: ... 5HT and NPY interneurons in the ACC 200 nl of virus (pAAV-hSyn-DIO-mCherry, Addgene 50459) was injected into the ACC ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus expressing gCaMP7f (AAV1-syn-jGCaMP7f-WPRE, stock concentration 3 x 1013 vg/mL, Addgene, 104488-AAV1)53 ...
-
bioRxiv - Neuroscience 2023Quote: We injected a conditional GCaMP expressing AAV virus (AAV9:FLEX:GCaMP6s; Addgene Plasmid #:100845; Chen, et al., 2013) in the AOB (Bregma 3.5 ...
-
bioRxiv - Bioengineering 2023Quote: ... Plasmids encoding the spike glycoprotein of vesicular stomatitis virus (VSV-G) and Cas9 were obtained from Addgene (cat ...
-
bioRxiv - Neuroscience 2023Quote: AAV5.CaMKII.GCaMP6f.WPRE.SV40 was the adeno-associated virus (AAV) used for calcium imaging and was obtained from Addgene at 2.3e13 GC-ml ...
-
bioRxiv - Neuroscience 2023Quote: ... The organoids were transduced with the AAV-hSYN-GFP virus two weeks before DIV70 (Addgene, 105539-AAV1). We dissociated the transduced organoids using papain digestion (Worthington ...
-
bioRxiv - Neuroscience 2024Quote: ... The dLight virus (700 nL of AAV5-hSyn-dLight 1.2; Addgene, Watertown, MA; Catalog No.111068-AAV5) was injected unilaterally into the NAc core (in mm ...