Labshake search
Citations for Addgene :
101 - 150 of 930 citations for Human DAG Fc Tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... into the TfR-sfGFP-myc tag-SpyCatcher003 plasmid (Keeble et al. [55]. Addgene #133451) through Gibson Assembly (primers listed in Table S3) ...
-
bioRxiv - Microbiology 2021Quote: ... SpyCatcher/Spy-tag and SUMO containing plasmids were purchased from Addgene (#133449 and #111560).
-
bioRxiv - Biochemistry 2021Quote: ... and pGAT2 (N-terminal polyhistidine and GST tags; Addgene #112588; last three genes (61)) by Twist Bioscience ...
-
bioRxiv - Molecular Biology 2023Quote: Mitochondrial immunoprecipitations were performed using K562 cells expressing an HA-mito tag (Addgene #83356) or a control MYC-mito tag (Addgene #83355 ...
-
bioRxiv - Cell Biology 2023Quote: The sequence coding for Halo tag was amplified from pSEMS-Halo7Tag-hFis (111136 Addgene) vector by using primers (5’-GCAATTCGATATGGGATCCGAAATCGGTACTGGCTTT CC-3’ and 5’-GGCCTCGAGATTAACCGGAAATCTCCAGAGTAG-3’).
-
bioRxiv - Cell Biology 2023Quote: ... the GFP fluorescent tags of ITGB3-GFP (gift from Jonathan Jones – Addgene plasmid #26653) and GFP-Talin1 (gift from Anna Huttenlocher – Addgene plasmid #26724 ...
-
bioRxiv - Cell Biology 2023Quote: ... or a pcDNA3.1-based plasmid containing a C-terminal 3xFLAG-V5 tag (Addgene 87063) for all other variants ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the pWPI-SLC7A11 cDNA with an HA tag was obtained from Addgene (#201643). By using Gateway cloning ...
-
bioRxiv - Cancer Biology 2019Quote: ... lentiviral vector to tag the nucleus of HFF1 cells was purchased from Addgene (Plasmid #21210). Trypsin/EDTA was purchased from Thermo Fisher Scientific (R001100) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we first eliminated the HA-tag in phage-UBC-NLS-HA-tdMCP-HaloTag (Addgene, 104098) and inserted IRES-tdPCP-SNAPtag-CAAX downstream of the tdMCP-HaloTag ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
-
bioRxiv - Genomics 2024Quote: ... GL261 cultures were partially transduced with sgRNA expression lentiviruses with a GFP tag (Addgene 187241)40 ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2022Quote: FUS SYQG LC containing a TEV cleavable N-terminal histidine tag (RP1B FUS LC, AddGene #127192), full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526 ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Immunology 2019Quote: Hem1 expression constructs containing C-terminal 3xFLAG-v5 tags were generated in a pcDNA3.1 backbone (Addgene) using Gateway cloning technology (Thermo Fisher ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Snrpb and Snrpd2 cDNA were cloned into a modified pCS2+8NmCherry vector lacking mCherry tag (Addgene) for their in vitro transcription ...
-
bioRxiv - Molecular Biology 2020Quote: Full-length ORF24 with a C-terminal Strep tag (pcDNA4/TO-ORF24-2xStrep) (Addgene plasmid #129742) was previously described (13) ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Biochemistry 2023Quote: Two vectors with C-terminal MBP (maltose-binding protein)-His6 Tag (2Cc-T; Addgene Plasmid #55209) or N-terminal His10-MBP Tag (2CT-10 ...
-
bioRxiv - Cell Biology 2023Quote: The α5 with C-terminal EGFP tag (α5-EGFP) was a gift from Rick Horwitz (Addgene plasmid #15238 ...
-
bioRxiv - Cell Biology 2023Quote: ... The α9 with C-terminal EGFP tag (α9-EGFP) was a gift from Dean Sheppard (Addgene plasmid #13600 ...
-
bioRxiv - Biophysics 2023Quote: ... coli expression vectors encoding either no tag (UC Berkeley Macrolab vector 2A-T, Addgene ID 29665) or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Neuroscience 2023Quote: ... An HA-tag was inserted after position G29 (referring to the numbering of Addgene Plasmid #49333) and flanked by short ...
-
bioRxiv - Developmental Biology 2021Quote: ... GST-human β-catenin (Addgene #24193), and NLS-mCherry (Addgene #49313 ...
-
bioRxiv - Molecular Biology 2022Quote: ... pscALPSpuro-HsACE2 (human) (Addgene, MA, USA) were co-transfected with psPAX2 and pCMV-VSV-G packaging plasmids into HEK293T cells using FuGENE 6 (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... human a-SYN (A53T mutant) (Addgene), and mt-Keima (Addgene) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Cancer Biology 2024Quote: ORF encoding human MARK2 (Addgene, 23404) was cloned into pFL system with an N-terminal Strep2SUMO tag ...
-
bioRxiv - Cell Biology 2022Quote: ... contains the coding sequence for the SNAPf-Tag (sequence from “pBS-TRE-SNAPf-WPRE”; plasmid #104106; Addgene) followed in frame with coding sequence for LacI-NLS (sequence taken from “Cherry-LacRep” ...
-
bioRxiv - Biochemistry 2020Quote: ... and Gibson-assembled into a pHR vector containing a C-terminal mCherry-CAAX fusion tag (Addgene #50839). Stellar E ...
-
bioRxiv - Biochemistry 2020Quote: Recombinant wild-type and mutant SpCas9 (1-1,368) possessing a C-terminal decahistidine tag (Addgene, no. 62731) was expressed and purified as described previously (35) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Isolated cDNAs were cloned in-frame with the V5 tag into the pMT-V5-HisB vector (Addgene) using the conventional restriction digestion and ligation method ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2021Quote: ... P1-8 and Photobacterium damselae were cloned into pNIC28-Bsa4 (N-terminal polyhistidine tag; Addgene #26103 (60)) ...
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... the APEX2-tag was amplified from the APEX2-NLS plasmid gifted by Alice Ting (Addgene plasmid # 124617) and introduced into pcDNA5 expression vectors ...
-
bioRxiv - Cell Biology 2023Quote: A 5’ 3xHA-Tag sequence were inserted into pMSCV-IRES-GFP II (MIG) plasmid (Addgene, Plasmid #52107;23). Human GATA2 WT ...
-
bioRxiv - Biochemistry 2023Quote: ... Full length PER1 and PER2 were cloned into the pEZYflag vector with a flag tag (Addgene #18700) resulting in the expression clones PER2 WT_pEZYflag ...
-
bioRxiv - Cell Biology 2023Quote: ... Cloning of Def16 sequence to pET plasmid containing an N-terminus Hisx6 tag and GFP (Addgene # 29663) was done by whole plasmid amplification using the indicated forward and reverse primers for GFP-Def16 (primers 1 and 2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 6 × 107 RPE1 cells were infected with the human sgRNA library (Human GeCKO v2 Library Cat#1000000048, Addgene) at an MOI of ∼0.3 ...
-
bioRxiv - Systems Biology 2021Quote: ... human knockout CRISPR v1 library (Addgene #67989) (39) ...
-
bioRxiv - Microbiology 2021Quote: The human CRISPR Brunello library (Addgene 73178) (16 ...
-
bioRxiv - Cell Biology 2023Quote: ... from human pcDNA3.1-2xFLAG-SREBP1a (#26801, Addgene), pcDNA3.1-2xFLAG-SREBP1c (#26802 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Sin1.1 was PCR-amplified from Addgene 73388 plasmid (gift from Taekjip Ha32 ...