Labshake search
Citations for Addgene :
1 - 50 of 1473 citations for Human Cyclin Y Like 3 CCNYL3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2021Quote: ... Cyclin D3 cDNA was cloned out of Rc/CMV cyclin D3 (CMV promoter; #10912 from Addgene) with PCR using the primers listed in Table 1 and cloned into pmCherry-C1 (CMV promoter ...
-
bioRxiv - Molecular Biology 2023Quote: ... was inserted into a pcDNA3.1-Hygro(-)-like with a C-terminal HRV 3C cut site and human Fc tag amplified from Addgene plasmid 145164 using standard cloning techniques ...
-
bioRxiv - Cell Biology 2021Quote: ... The cyclin D1-APEX plasmids were constructed by combining the PCR fragment of cyclin D1 from the cyclin D1-Flag plasmid and APEX from pcDNA3 APEX-nes (Addgene) into XPack CMV constructs (System Biosciences) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNAs encoding cyclin D1 WT and cyclin D1 (T286A) were PCR amplified from pcDNA cyclinD1 HA and pcDNA cyclinD1 HA T286A (Addgene plasmids #11181 and # 11182 ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs encoding either APC/C resistant (APC/CR) mVenus-cyclin A2 or mVenus-cyclin B1 were cloned into pINDUCER20 (plasmid #44012; Addgene) by replacing the gateway cassette sequence and were synthesized by Twist Biosciences ...
-
bioRxiv - Biophysics 2020Quote: ... human 3’ HP1α-AID-sfGFP 2A PuroR (Addgene 127906) and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907 ...
-
bioRxiv - Molecular Biology 2021Quote: ... human GFP-RBFOX2 (transcript variant 3) (Addgene, plasmid #63086) or empty vector (pcDNA 5 ...
-
bioRxiv - Biochemistry 2021Quote: ... N-terminal His6 plus small ubiquitin-like modifier (SUMO; RRID:Addgene_29711); or N-terminal His6 plus green fluorescent protein (GFP ...
-
bioRxiv - Cancer Biology 2019Quote: ... pInducer20 empty vector and pInducer20 Cyclin E1 plasmids were obtained from Addgene. The FANCJ K/O U2OS cells complemented with FANCJ WT or FANCJS990A were further infected with the respected virus to express the empty vector or Cyclin E1 in a doxycycline inducible manner ...
-
bioRxiv - Cancer Biology 2023Quote: ... and MIGR1-Cyclin E-AA (Addgene #47498, a gift from Alex Minella)67 for expressing the mutant Cyclin E ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene# 43803). The LEU2 marker was replaced with the SpHIS5 marker by homologous recombination in yeast ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Cell Biology 2022Quote: ... sgRNA for human ATP6V0C (5’-GAATAGTCGGGGCTGCTGGG-3’) and ATP6V0D1 (5’-TCGATGACTGACACCGTCAG-3’) were cloned to lentiCRISPR v2 plasmid (Plasmid #52961, Addgene), followed by virus package and infection procedures as described previously69 ...
-
bioRxiv - Biophysics 2020Quote: ... and a guide RNA/Cas9 plasmid pX330 human 3’ HP1α gRNA (Addgene 127907) with Lipofectamine 2000 according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... and p426-SNR52p-gRNA.CAN1.Y-SUP4t (Addgene plasmid # 43803) were a gift from George Church and were used as the backbone plasmids for all studies (25) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and p426-SNR52p-gRNA.CAN1.Y-SUP4t plasmid (Addgene #43803). Constitutive expression of Cas9 is driven by the TEF1 promoter and constitutive expression of the gRNA is driven by the SNR52 promoter ...
-
bioRxiv - Neuroscience 2023Quote: ... we utilized PiggyBac integration technology to express PB-tet-NGN2 (Addgene 172115; “cortical-like” neurons) and PB-tet-hNIL (Addgene 172113 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Rc-CMV-Cyclin E (#8963) and lentiviral constructs pLB (#11619) and pLKO (#8453) were purchased from Addgene. shRNA oligos for Spy1 and a scrambled control were ligated into the pLKO and pLB vectors ...
-
bioRxiv - Cell Biology 2024Quote: ... or human Mon1b (5’-GATGTGCAGATGGAGGTCGG-3’) were cloned into pSpCas9(BB)-2A-Puro (PX459) (Addgene #48139). The donor constructs used for homologous recombination were generated by cloning into the pUC19 vector with two ∼600-800-nucleotide fragments of genomic DNA upstream and downstream of the start codon of human USP8 ...
-
bioRxiv - Biochemistry 2024Quote: ... human PLD3 sgRNA (5′-3′) was cloned into pSpCa9(BB)-2A-Puro (PX459) V2.0 (Addgene #62988) as described (Ran et al. ...
-
bioRxiv - Genomics 2021Quote: ... shRNA-specific plasmid together with lentiviral packaging plasmids like VSVG (a gift from Bob Weinberg, Addgene #8454), and PAX2 ...
-
bioRxiv - Genomics 2021Quote: ... These cells were co-transfected with lentiviral packaging plasmids like VSVG (a gift from Bob Weinberg, Addgene #8454) and PAX2 (a gift from Didier Trono ...
-
bioRxiv - Developmental Biology 2019Quote: The GLI-3 bs-2 plasmid carrying the human GLI3 (Kinzler et al., 1988) was purchased from Addgene. F387F*fs mutation was generated in the vector pCDNA3 hGli3 using Q5 site directed mutagenesis kit (NEB ...
-
bioRxiv - Synthetic Biology 2019Quote: ... pGAL4AD-x and pGAL4BD-y plasmids were purchased from Addgene (28246 and 28244) as pGAL4AD-CIB1 and pGAL4BD-Cry2 (4) ...
-
bioRxiv - Microbiology 2020Quote: All virus-like particles were generated in HEK293T cells via calcium phosphate transfection using packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Genetics 2023Quote: ... individual single and 3-plex crRNA constructs were cloned into the human U6 promoter-driven expression vector pRG212 (Addgene 149722 ...
-
bioRxiv - Genomics 2019Quote: ... We obtained p426-crRNA-CAN1.Y and p414-TEF1p-Cas9-CYC1t [97] from Addgene. To create a BaeI cleavable cassette for easy guide cloning ...
-
bioRxiv - Cell Biology 2019Quote: The Polo-like binding domain (PBD) of PLK1 (amino acid 326 to amino acid 603) was amplified from the pTK24 plasmid (Addgene) and cloned into a pT7-His6-SUMO expression vector using NEB Gibson assembly (Gibson Assembly Master Mix ...
-
bioRxiv - Immunology 2022Quote: ... lentivirus-like particles were made by transfecting HEK293T cells with the plasmids psPAX2 (gift from Didier Trono, Addgene plasmid # 12260), pMD2.G (gift from Didier Trono ...
-
bioRxiv - Microbiology 2023Quote: ... SARS-CoV-2 virus-like particles were prepared as previously described (68) by co-transfecting plasmids for N (Addgene 177937); M and E (Addgene 177938) ...
-
bioRxiv - Bioengineering 2023Quote: A DNA sequence encoding the CD47 Ig-like domain (Gln19 – Ser135) was cloned into the pCTCON2 yeast-surface display vector (Addgene) using the NheI and BamHI sites ...
-
bioRxiv - Genetics 2023Quote: ... following the manufacturer’s protocol with AAVS1 targeting vector and predesigned transcription activator-like effector nucleases (hAAVS1 TALEN Left and Right were gifts from Su-Chun Zhang, Addgene plasmid # 52341 & 52342 ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Molecular Biology 2023Quote: - recombinant pGEX-4T-3-P53: The human-p53 cDNA was previously cloned in the EcoRI site of pGEX-4T3 (Addgene_79149) under the lac-trp hybrid promoter that is inducible by IPTG ...
-
bioRxiv - Neuroscience 2019Quote: ... was generated via Gibson Assembly based on pmyo-3::QuasAr::mOrange and pPD96.52 (pmyo-3, Fire Lab Vector Kit, Addgene plasmid #1608), using restriction enzymes BamHI and XbaI and primers QUASAR_fwd (5’-cccacgaccactagatccatATGGTAAGTATCGCTCTGCAG-3’ ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cyclin and Geminin modules were amplified from cDNA of the murine CH12 cell line and Cas9 from described plasmids (Addgene plasmid #43861) [36] ...
-
bioRxiv - Microbiology 2022Quote: The SARS CoV-2 papain-like protease (PLpro) domain of Nsp3 was cloned from a doxycycline-inducible piggyBac transposon vector (PB-TAC-ERP2, Addgene# 80478) containing the synthesized full-length Nsp3 from the Wuhan-Hu-1 SARS CoV 2 strain (Alvarez and Yao ...
-
bioRxiv - Genetics 2021Quote: ... uracil glycosylase inhibitor (UGI) and 3’UTR of human ATP5B was amplified from the published DdCBE construct (Addgene plasmid no. 157843). The PCR product was digested with the restriction enzymes XbaI and EcoRI ...
-
bioRxiv - Biochemistry 2023Quote: ... or the control vector, or sgRNA vectors targeting human PML exon 3 (sense: CACCGGcggtaccagcgcgactacg, antisense: AAACcgtagtcgcgctggtaccgCC) inserted in pLentiV2 vector (Addgene, 52961) along with pMD2.G and psPAX into 293T cells ...
-
bioRxiv - Developmental Biology 2019Quote: ... was a gift from Elisa Izaurralde (Addgene plasmid # 37370) (78) ...
-
bioRxiv - Biophysics 2023Quote: ... a pQE-30/pcl-ts ind+ plasmid containing a His6-small ubiquitin-like modifier (SUMO) SARS-CoV-2 nsp12 and untagged nsp7 and 8 (Addgene no. 160540) was transformed into Escherichia coli BL21 cells (Agilent) ...
-
bioRxiv - Cell Biology 2020Quote: ... sgRNA oligonucleotides targeting the human Pex5 locus (at 5’-GCTCGCCGGGCACTTCACCC-3’) were ligated into the BbsI site of pSpCas9(BB)-2A-GFP (PX458, Addgene Plasmid #48138) to generate pVD1629 ...
-
bioRxiv - Neuroscience 2020Quote: ... CRISPR guide RNA sequence (sgRNA#3 CTCAACACCATCTTCATCCG) targeting the human NLK locus was cloned into pSpCas9 (BB)-2A-GFP (Addgene #481387 PX458). Wild-type iPSCs were transfected with gRNA and Cas9-expressing plasmid using an Amaxa Nucleofector 2b and successfully transfected cells were collected by FACS ...
-
bioRxiv - Cell Biology 2019Quote: ... was generated by transfecting HEK293T cells with pC13N-dCas9-BFP-KRAB26 and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA-In Stem (VitaScientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSCs were transfected with pC13N-dCas9-BFP-KRAB and TALENS targeting the human CLYBL intragenic safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using DNA In-Stem (VitaScientific) ...
-
bioRxiv - Bioengineering 2023Quote: ... iPSCs were transfected with LSD-dCas9-BFP-KRAB and TALENS targeting the human CLYBL safe harbor locus (between exons 2 and 3) (pZT-C13-R1 and pZT-C13-L1, Addgene #62196, #62197) using transfection reagent ...
-
bioRxiv - Cancer Biology 2022Quote: ... human E2F5 and human DP1 were purchased from Addgene, whereas the ORF encoding human p130 from Origene.
-
bioRxiv - Neuroscience 2021Quote: Human DRD1 and DRD2 in pcDNA vectors were achieved using the PRESTO-Tango kit (Addgene). To generate R-DRD1 ...
-
bioRxiv - Bioengineering 2022Quote: Assembloids were formed with VTA- and PFC-like spheroids such that one spheroid type was transduced with AAV9-GCaMP6f (Addgene, cat# 100836-AAV9) while the other was transduced with either an inhibitory or excitatory DREADDs virus (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... and RRP46_589.gRNA with AC9888 and AC6809 using p426-SNR52p-gRNA.CAN1.Y-SUP4t plasmid template (Addgene #43803) and cloning of SphI/KpnI-digested gRNA products into pAC3846 digested with SphI/KpnI ...