Labshake search
Citations for Addgene :
251 - 300 of 2026 citations for Human Chemokine C X C Motif Receptor 5 CXCR5 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Dphox and phox vectors were C-terminally tagged with GFP by infusion cloning in frame into CAG-GFP (Addgene) using the following primers ...
-
bioRxiv - Neuroscience 2022Quote: ... was digested with NheI/KpnI and ligated with similarly digested pPD96.52 (Fire lab C. elegans Vector Kit 1999; 1608: L2534, Addgene) to generate pKMC166 (myo-3p::mCherry) ...
-
bioRxiv - Developmental Biology 2022Quote: ... that contain DENDRA-expressing sequences optimized for use in C. elegans (Gallo et al. 2010) are annotated in Addgene as containing DENDRA2 (e.g., pEG545, Addgene plasmid #40116 and pEG345 ...
-
bioRxiv - Biochemistry 2022Quote: The C-terminal P2A-EGFP sequence was added to SaABE8e or pCMV-PE2 (Addgene IDs 138500 and 132775, respectively), and the N-terminal BPNLS was added to an SpCas9 plasmid similar to pCMV-T7-SpCas9 (Addgene plasmid ID 139987 ...
-
bioRxiv - Cancer Biology 2022Quote: ... pTag-RFP-C-h-Rab11a-c-Myc was a gift from James Johnson (Addgene plasmid #79806; http://n2t.net/addgene:79806; RRID: Addgene_79806)66 ...
-
bioRxiv - Cell Biology 2019Quote: ... The h-Fyn gene source was from pRK5-c-Fyn (a gift from Dr. Filippo Giancotti, Addgene plasmid # 16032). Biosensors were constructed using gene fusion ...
-
bioRxiv - Cell Biology 2019Quote: ... The sequence encoding mRuby2 fused to the C-terminus of Paxillin was cloned into the pMSCV retroviral backbone (Addgene). Transduced mRuby2-positive cells were single cell cloned by automated cell deposition unit using a BD FACSAria (BD biosciences) ...
-
bioRxiv - Biochemistry 2021Quote: ... the specific sybody and the C-terminal MBP were cloned in parallel into the expression vector pBXNPH3M (Addgene #110099) 38–40 using FX cloning 41 ...
-
bioRxiv - Genetics 2020Quote: ... The guides were inserted into a deadCas9-KRAB-T2A-GFP lentiviral backbone containing both the guide RNA under the U6 promoter and dead-Cas9-KRAB and GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, a gift from Charles Gersbach, Addgene plasmid #71237 RRID:Addgene_71237). The guides were inserted into the backbone using annealed oligos and the BsmBI cloning site ...
-
bioRxiv - Cell Biology 2020Quote: ... The codon-optimized mCherry sequence with synthetic introns and a C-terminal linker was amplified from pJJR83 (Addgene #75028). Correct amplification and assembly was confirmed by Sanger sequencing ...
-
bioRxiv - Molecular Biology 2021Quote: Full-length and C-terminal truncated KDM6B cDNA was amplified by PCR from KDM6B plasmids (Addgene, #21212 and #21214) and subcloned into pLVX-Ubc-FLAG vector ...
-
bioRxiv - Biochemistry 2020Quote: ... After cooling on ice for five min the sample was treated with 5.0 µL of PNGase F for 20 hr at 37 °C (in-house, Addgene #114274 ...
-
bioRxiv - Cell Biology 2021Quote: ... Either a control vector (c-Flag pcDNA3 was a gift from Stephen Smale (Addgene plasmid #20011; http://n2t.net/addgene:20011; RRID:Addgene_20011(47)) ...
-
bioRxiv - Cell Biology 2022Quote: ... hTERT-RPE1 Plk1 FRET Sensor cells were prepared by transfecting Plk1-FRET sensor c-jun substrate plasmid37 (Addgene: 45203) in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Dnmt3a CD and the C-terminal part of mouse Dnmt3L (3a3L) were amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827). The resulting constructs (collectively ...
-
bioRxiv - Cell Biology 2023Quote: ... mRuby2-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid # 55889; http://n2t.net/addgene:55889; RRID: Addgene_55889). PaGFP-UtrCH was a gift from William Bement (Addgene plasmid # 26738 ...
-
bioRxiv - Cell Biology 2023Quote: ... mPA-GFP-MyosinIIA-C-18 was a gift from Michael Davidson (Addgene plasmid # 57149; http://n2t.net/addgene:57149; RRID: Addgene_57149). pBa-KIF5C 559-tdTomato-FKBP was a gift from Gary Banker (Addgene plasmid # 64211 ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCDH-Flag-c-MYC was a gift from Hening Lin (Addgene plasmid # 102626; http://n2t.net/addgene:102626; RRID: Addgene_102626).
-
bioRxiv - Microbiology 2023Quote: ... Pmyo-3::mCherry] by cloning 1397bp promoter and 1266bp coding sequence of col-51 in frame with GFP into the vector pPD95.77 (Fire Lab C. elegans vector kit; Addgene) and microinjecting to N2 worms.
-
bioRxiv - Neuroscience 2023Quote: ... The guides were inserted into a deadCas9-KRAB-T2A-GFP lentiviral backbone containing both the guide RNA under the U6 promoter and dead-Cas9-KRAB and GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP, a gift from Charles Gersbach, Addgene plasmid #71237 RRID:Addgene_71237). The guides were inserted into the backbone using annealed oligos and the BsmBI cloning site ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We first constructed pKB11 by replacing the TRP1 auxotrophic cassette of pDEST-DHFR F[1,2]-C (TRP1) (Addgene #177795) (Marchant et al ...
-
bioRxiv - Cell Biology 2024Quote: Plk1 FRET sensor c-jun substrate was a gift from Michael Lampson (Addgene plasmid #45203; http://n2t.net/addgene:45203; RRID:Addgene 45203). Cells were transiently transfected with a and plated onto glass-bottom plates ...
-
bioRxiv - Molecular Biology 2024Quote: ... The G418 (Geneticin) resistance gene was subcloned from pDEST-CMV-C-eGFP (a gift from Robin Ketteler, Addgene: 122844) and inserted into pLX303-DD-HA-ER-I-PpoI using In-Fusion cloning ...
-
bioRxiv - Neuroscience 2022Quote: ... a mammalian expression vector encoding an EGFP-human 0N4R tau fluorescent fusion protein was obtained from Addgene (catalog # 46904). This plasmid was developed by the lab of Karen Ashe [16] ...
-
bioRxiv - Genetics 2024Quote: Human pcDNA3-FLAG-RBBP5 plasmid used in the protein expression experiments was obtained from Addgene (Cat# 15550, MA, USA). Candidate variants were introduced using QuikChange II Site-directed mutagenesis kit according to manufacturer’s protocol (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... 5 x 104 MDCK II cells were transiently transfected with pSpCas9(BB)-2A-Puro (PX459) plasmids (Addgene, plasmid #62988, MA, USA) (Ran et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... Addgene) designer receptors exclusively activated by designer drugs (DREADD) or control (pAAV8-hSyn-EGFP; Addgene) were delivered into the dLS as described for GCaMP7 (see 2.4.1 ...
-
bioRxiv - Biophysics 2021Quote: ... The pET C-terminal TEV His6 cloning vector with BioBrick polycistronic restriction sites (9Bc) was a gift from Scott Gradia (Addgene plasmid #48285 ...
-
bioRxiv - Biophysics 2022Quote: ... The plasmid MCherry-Actin-C-18 was a gift from Michael Davidson (Addgene plasmid 54967; http://n2t.net/addgene : 54967; RRID : Addgene_54967 [51]).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-GGG GGG GGC GGA ATT CTC AGT CTA TCT TTT CTT TCT GGA CCA GTC TGG GAG C-3’ and pmScarlet-C1 (gift from Dorus Gadella; Addgene plasmid # 85042 ...
-
bioRxiv - Biochemistry 2020Quote: ... To construct PTP1BPS* and PTP1BPS**, we amplified C-terminal regions of PTP1B (residues 299-405 and 299-435, respectively) from pGEX-2T-PTP1B (Addgene) and used Gibson assembly to join them to the C-terminus of PTP1BPS (50°C for 1 hr ...
-
bioRxiv - Neuroscience 2020Quote: ... The constructs were subcloned using restriction digestion into the pHL-sec vector containing a C-terminal 6xHis-tag (Addgene # 99845). Restriction sites for subcloning were introduced by PCR at the 5’ and 3’ ends of scFv-Clasp heavy and light chains (light chain ...
-
bioRxiv - Biophysics 2021Quote: The construct for the adaptor protein mTurquoise-SRC-N-18 (SRC with mTurquoise fused to its C-terminus via a linker) was a gift from Michael Davidson (Addgene plasmid # 55560 ...
-
bioRxiv - Bioengineering 2020Quote: Synthetic thermal switches were produced as gene blocks by IDT and cloned into the Lego-C backbone (Addgene plasmid #27348). The core promoters were truncated immediately upstream of their previously described TATA boxes at their 5’-termini and at their translational start site on their 3’-termini 76-78 ...
-
bioRxiv - Cell Biology 2021Quote: pTRIP-SFFV-EGFP-NLS and the coding sequences of mEmerald-Lamin A/C and mEmerald-Lamin B1 were from Addgene. pLVX-N-GFP was a kind gift from Prof ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584 ...
-
bioRxiv - Neuroscience 2021Quote: The guides were inserted into a deadCas9-KRAB-T2A-GFP lentiviral backbone containing both the guide RNA under the U6 promoter and dead-Cas9-KRAB and GFP under the Ubiquitin C promoter (pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP was a gift from Charles Gersbach (Addgene plasmid #71237 ...
-
bioRxiv - Cancer Biology 2020Quote: ... SK-N-BE(2)-C cells were transduced with lentiviral constructs for stable expression of the different tested RRM2 promotor targeting sgRNAs (Addgene) (MP-I-1142 sg86RRM2 ...
-
bioRxiv - Microbiology 2022Quote: ... mEmerald-CLIP170-N-18 and mCherry-ATG3-C-18 were gifts from Michael Davidson (Addgene cat. 54967, 54044 and 54993) [63] ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and LY6C1 (NM_010741.3) were separately cloned into an expression vector backbone with a C-terminal Fc-tag (Addgene plasmid #115773) using Xbal/EcoRV ...
-
bioRxiv - Molecular Biology 2019Quote: ... The mammalian expression vector for St1Cas9 (LMD-9) fused to SV40 NLS sequences at the N- and C-terminus (MSP1594_2x_NLS; Addgene plasmid #110625) was constructed from MSP1594 (Kleinstiver et al. ...
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Cell Biology 2020Quote: ... of a TubB1 sequence fragment synthesised as a gBlock by Integrated DNA Technologies (IDT) and a C-terminal mApple empty backbone (mApple-C1 was a gift from Michael Davidson (Addgene plasmid # 54631 ...
-
bioRxiv - Immunology 2021Quote: ... Full length FOXN1 cDNA without a stop codon was cloned into vector backbones positioning at its C-terminus either a flag (pCSF107mT-GATEWAY-3’-FLAG, Addgene), myc (pCSF107mT-GATEWAY-3’-Myc tag ...
-
bioRxiv - Immunology 2021Quote: ... The lentiviral HLA-C expression plasmids were co-transfected with the vesicular stomatitis virus-G envelope plasmid pMD2.G (Addgene) and packaging plasmid psPAX2 (Addgene) ...
-
bioRxiv - Neuroscience 2020Quote: ... membrane-trafficking optimized variant was generated by fusing an additional trafficking signal from the potassium channel Kv2.112 to the C-terminus of Chrimson (pAAV-hSyn-somBiPOLES-mCerulean; Addgene #154945). For expression in GABAergic neurons ...
-
bioRxiv - Genetics 2019Quote: ... Only a single site upstream of the c(3)GccΔ1 deletion was selected (AAAGCTTTGTTGGCCTGTATTGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense (CTTCGAAAGCTTTGTTGGCCTCTAT ...
-
bioRxiv - Genetics 2019Quote: ... and guide 2 c(3)GccΔ3: TCTTGAACAACAATCTGTCAAGG) and constructed into the pU6-BbsI-chiRNA guide RNA (gRNA) plasmid (Addgene 45946). Sense and antisense oligonucleotides (guide 1 c(3)GccΔ2 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The GFP fragment was amplified and C-terminally Flag-tagged using primers GFP_IndOE_F & R and the construct pT2-CAG-fGFP (Addgene plasmid #108714) as template ...