Labshake search
Citations for Addgene :
401 - 450 of 1314 citations for Hepatitis E Virus Capsid Protein ORF2 Mouse Fc Tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... The organoids were transduced with the AAV-hSYN-GFP virus two weeks before DIV70 (Addgene, 105539-AAV1). We dissociated the transduced organoids using papain digestion (Worthington ...
-
bioRxiv - Neuroscience 2024Quote: ... The dLight virus (700 nL of AAV5-hSyn-dLight 1.2; Addgene, Watertown, MA; Catalog No.111068-AAV5) was injected unilaterally into the NAc core (in mm ...
-
bioRxiv - Microbiology 2022Quote: ... pGBW-m4252984 (SARS-CoV-2 E [envelope]) was a gift from Ginkgo Bioworks (Addgene plasmid #153898 ...
-
bioRxiv - Plant Biology 2024Quote: ... for Level 1 and 3 and pEven1-4 (pCsA-E, Addgene plasmids # 136067-136070) for Level 2 ...
-
bioRxiv - Cancer Biology 2019Quote: ... lentiviral vector to tag the nucleus of HFF1 cells was purchased from Addgene (Plasmid #21210). Trypsin/EDTA was purchased from Thermo Fisher Scientific (R001100) ...
-
bioRxiv - Molecular Biology 2022Quote: ... we first eliminated the HA-tag in phage-UBC-NLS-HA-tdMCP-HaloTag (Addgene, 104098) and inserted IRES-tdPCP-SNAPtag-CAAX downstream of the tdMCP-HaloTag ...
-
bioRxiv - Biochemistry 2023Quote: ... N-terminal or C-terminal heptahistidine (His7) tags were added using pQLinkH (Addgene plasmid 13667) or a modified derivative ...
-
bioRxiv - Genomics 2024Quote: ... GL261 cultures were partially transduced with sgRNA expression lentiviruses with a GFP tag (Addgene 187241)40 ...
-
bioRxiv - Neuroscience 2023Quote: ... The amplicons were inserted into the pCMV-Tag-2b or pGEX-5X-3 vector (Addgene). Spastin mutants were generated using the Quickchange Kit (Agilent ...
-
bioRxiv - Neuroscience 2019Quote: ... double inverted open (DIO)-reading frame adeno-associated virus (AAV): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene; #44362) or AAV5-Ef1a-DIO-Cherry (UNC viral vector core ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus carrying the GCaMP6f gene (AAV2/1:hSyn-GCaMP6f) was obtained from Addgene (100837-AAV1) with titer ≥ 1×1012 ...
-
bioRxiv - Neuroscience 2021Quote: ... 450nl of a mostly anterograde virus containing the Cre recombinase under CamKII promoter to target pyramidal cells (AAV1_CamKII_Cre_SV40, Addgene, USA) was injected into the right MEC (+3.2mm laterally from Lambda along the lambdoid suture and DV -2.5mm from skull level) ...
-
bioRxiv - Neuroscience 2020Quote: ... mice were injected with the virus encoding AAV9.CaMKII.GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40, gift from James M. Wilson, Addgene viral prep # 100834-AAV9) at the following coordinates ...
-
bioRxiv - Biochemistry 2021Quote: Tobacco Etch Virus protease (TEV) was a gift from Helena Berglund (Addgene plasmid # 125194; http://n2t.net/addgene:125194; RRID:Addgene_125194)40 ...
-
bioRxiv - Neuroscience 2022Quote: ... 70–100 nl of AAV5-CaMKIIa-hChR2(H134R)-EYFP (UNC vector core, Karl Deisseroth virus stock/ Addgene #26969) was injected into either the ventral (AP = −2.8 – −3.1 mm ...
-
bioRxiv - Neuroscience 2021Quote: ... The visual cortex was injected with a total of 2–3 μl of virus solution (1e13 GC/ml) containing AAV9-Syn-GCaMP6s.WPRE.SV40 (Penn Vector Core or Addgene) through a beveled glass micropipette (tip size 10–20 μm diameter ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Neuroscience 2023Quote: ... the Cre-dependent construct pAAV_hSyn1-SIO-stGtACR2-FusionRed packaged in an adeno-associated virus (AAV1, #105677-AAV1, Addgene) was injected into primary somatosensory cortex (S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... we performed an additional control experiment in which we injected a cre-dependent mCherry virus (pAACV-hSyn-DIO-mCherry; a gift from Bryan Roth; Addgene plasmid #50459; http://n2t.net/addgene:50459; RRID:Addgene_50459) into the basal forebrain of 3 ChAT-cre mice ...
-
bioRxiv - Neuroscience 2024Quote: ... AAV-DJ-hSYN1::mTurquoise2 (Produced by Stanford University Neuroscience Gene Vector and Virus Core using Addgene, plasmid #99125), AAV-DJ-hSYN1::mCherry (Stanford University Neuroscience Gene Vector and Virus Core ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f ...
-
bioRxiv - Cell Biology 2019Quote: ... SBP-EGFP-E-cadherin and APPL1-mCherry were obtained from Addgene (#65292 and #27683, respectively).
-
bioRxiv - Neuroscience 2019Quote: ... region of homology to plasmid pSLQ1651-sgTelomere(F+E) (Addgene #51024; (Chen et al., 2013)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The sgRNA was cloned using the BbsI site of lentiviral vector pLentiCRISPR-E (Addgene, 78852) as described (https://media.addgene.org/cms/filer_public/6d/d8/6dd83407-3b07-47db-8adb-4fada30bde8a/zhang-lab-general-cloning-protocol-target-sequencing_1.pdf) ...
-
bioRxiv - Immunology 2023Quote: ... Platinum-E retroviral packaging cells were transfected transiently with modified pMIG retroviral plasmids (Addgene, #9044) or a second-generation anti-hCD19 CAR construct (MSCV-myc-CAR2A-Thy1.1 ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2022Quote: FUS SYQG LC containing a TEV cleavable N-terminal histidine tag (RP1B FUS LC, AddGene #127192), full-length FUS with an N-terminal histidine tag and maltose-binding protein fusion (pTHMT FUS 1-526 ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Cell Biology 2022Quote: ... MAC (BirA-Ha-Strep-tag II)-N was a gift from Markku Varjosalo (Addgene plasmid # 108078). FLAG-tagged TR-TUBE has been previously published (Yoshida et al. ...
-
bioRxiv - Immunology 2019Quote: Hem1 expression constructs containing C-terminal 3xFLAG-v5 tags were generated in a pcDNA3.1 backbone (Addgene) using Gateway cloning technology (Thermo Fisher ...
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Genomics 2021Quote: We used PCR to add V5 epitope tags to the 3’ end of FoxA1 (Addgene #120438) and Hnf4a (Addgene #120450 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Snrpb and Snrpd2 cDNA were cloned into a modified pCS2+8NmCherry vector lacking mCherry tag (Addgene) for their in vitro transcription ...
-
bioRxiv - Molecular Biology 2020Quote: Full-length ORF24 with a C-terminal Strep tag (pcDNA4/TO-ORF24-2xStrep) (Addgene plasmid #129742) was previously described (13) ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Cell Biology 2023Quote: The α5 with C-terminal EGFP tag (α5-EGFP) was a gift from Rick Horwitz (Addgene plasmid #15238 ...
-
bioRxiv - Cell Biology 2023Quote: ... The α9 with C-terminal EGFP tag (α9-EGFP) was a gift from Dean Sheppard (Addgene plasmid #13600 ...
-
bioRxiv - Biophysics 2023Quote: ... coli expression vectors encoding either no tag (UC Berkeley Macrolab vector 2A-T, Addgene ID 29665) or an N-terminal TEV protease-cleavable His6-tag (UC Berkeley Macrolab vector 2B-T ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Neuroscience 2023Quote: ... An HA-tag was inserted after position G29 (referring to the numbering of Addgene Plasmid #49333) and flanked by short ...
-
bioRxiv - Neuroscience 2021Quote: ... the barcoded rabies virus plasmid library (131.36 mg) and CAG-promoter driven plasmids for T7 polymerase (23.66 mg, Addgene 59926) and SAD-B19 helper proteins (N ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nl of the adeno-associated virus (AAV) AAV1-SynGCaMP6s (diluted to 2.9×1012 GC/ml, Addgene 100844-AAV1) was injected into right motor cortex (1.6 mm lateral ...
-
bioRxiv - Neuroscience 2020Quote: ... hippocampal slice cultures were microinjected in the CA3 area with an adeno-associated virus (AAV7 or AAV9) to express either ChR2 ET-TC60 (RRID:Addgene_101361) or ChrimsonR61 (RRID:Addgene_59171 ...
-
bioRxiv - Neuroscience 2021Quote: ... Black-6 mice were first injected with 120nL of a retrograde virus encoding Cre (AAVrg-Ef1a-mCherry-IRES-Cre, titer of 1.37 x 10^13, Addgene viral prep # 55632-AAVrg ...
-
bioRxiv - Cancer Biology 2019Quote: Brunello and Calabrese CRISPR guide virus libraries were obtained from the Broad Genomic Perturbation Platform (also available from Addgene). The pXPR_003 ...
-
bioRxiv - Microbiology 2020Quote: All virus-like particles were generated in HEK293T cells via calcium phosphate transfection using packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2020Quote: ... A pulled glass pipette front-loaded with virus carrying GCaMP6f (AAV1-hSyn-GCaMP6f-WPRE-SV40, 2.3 × 1013 gc/mL, catalog # 100837-AAV1, Addgene) was lowered into GC (1.9-2.0 mm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with 100 nL of AAV virus expressing GCaMP6s into three locations within primary visual cortex (AAV1.Syn.GCaMP6f.WPRE.SV40; Addgene 100837-AAV1) at two depths (150 and 300 µm ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice that were cre-positive received the AAV-hM3D injection (test mice) or a control virus AAV-YFP (Addgene) (control mice ...