Labshake search
Citations for Addgene :
1 - 50 of 1200 citations for Hepatitis E Virus Capsid Protein ORF2 His tag since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Hepatitis Delta Virus sequence from the pSVL(D3) plasmid99 (Addgene plasmid #29335) (https://www.addgene.org/29335/) ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID ...
-
bioRxiv - Cell Biology 2023Quote: A synthetic sequence corresponding to 2A peptide from Thoseaasigna virus capsid protein and BspTI (AflII) restriction site was first cloned to pCXLE-EGFP (Plasmid #27082, Addgene, www.addgene.org) (Okita et al. ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139113)
-
bioRxiv - Immunology 2019Quote: ... and 6-His tag (Addgene plasmid# 50803) [36] ...
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139112)
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139116)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139117)
-
bioRxiv - Microbiology 2020Quote: ... or human ACE2 ectodomain (containing a C-terminal His tag) were made according to the E and F sections of the pLKO.1 Protocol from Addgene (http://www.addgene.org/protocols/plko/) ...
-
bioRxiv - Biochemistry 2020Quote: ... His-tag purification (Addgene ID: 139124, 139125 respectively)
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139126, 139127, 139128)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139114, 139115 respectively)
-
bioRxiv - Physiology 2022Quote: ... The pTwist-EF1a carrying the SARS-CoV-2 E protein with 2xSTREP tags were obtained from Addgene. pCMV-rpHluorin-N1 was a kind gift from Dr ...
-
bioRxiv - Biochemistry 2021Quote: ... by cloning our codon optimized Syx gene into vectors containing the following tags that are cleavable with tobacco etch virus (TEV) protease: N-terminal His6 plus maltose binding protein (MBP; RRID:Addgene_29708); C-terminal MBP plus His6 (Addgene_37237) ...
-
bioRxiv - Neuroscience 2020Quote: ... and capsid plasmid (pAAV9, Addgene) by polyethylenimine (PEI ...
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Molecular Biology 2021Quote: ... and TopBP1 was produced as a fused protein with a GST-tag (GST TopBP1 (aa 32-1522) His from Addgene; plasmid # 20375) ...
-
bioRxiv - Bioengineering 2023Quote: ... The AAV capsid AAV-X1.1 (Addgene 196836 ...
-
bioRxiv - Neuroscience 2023Quote: ... SV40 (AAV9 capsid serotype, Addgene 100837) was applied to the somatosensory cortex in each hemisphere ...
-
bioRxiv - Cell Biology 2020Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol (Tropea et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... A plasmid expressing 8X-His-TEV-8X-Arg tag protease was obtained from Addgene and purified according to the published protocol(Tropea et al. ...
-
bioRxiv - Biochemistry 2021Quote: ... Nsp14 was subcloned into a modified pBIG1a vector containing a pLIB-derived polyhedrin expression cassette to either contain an N-terminal 3xFlag-6His tag (sequence: MDYKDHDGDYKDHDIDYKDDDDKGSHHHHHHSAVLQ-nsp14) or no tag to generate SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164). Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2022Quote: ... 238 μg rep-cap plasmid encoding AAV5 capsid proteins (pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ; http://n2t.net/addgene:104964 ; RRID:Addgene_104964) and 64.6 μg of either the CalEx plasmid (pZac2.1-GfaABC1D-HA-hPMCA2w/b ...
-
bioRxiv - Bioengineering 2024Quote: ... capsid and helper plasmids (Addgene No. 112865 and 112867) were incubated for five days until harvest and precipitation using PEG and NaCl ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Bioengineering 2020Quote: ... USA) and AAV2-7m8 capsid plasmid (7m8; Addgene No. 64839) using the calcium phosphate method (Hung et al. ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-eGFP, Addgene) was also infused bilaterally into either BLA (n=7) ...
-
bioRxiv - Molecular Biology 2020Quote: ... envelope and capsid plasmids obtained from Addgene (#83889, #12260 and #12259) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... These genomes were packaged in serotype 1 AAV capsids by Addgene (catalog numbers 52473-AAV1 ...
-
bioRxiv - Microbiology 2024Quote: ... pHelper and pAAV-2.5 capsid plasmids were used (Addgene and (16). For VLP production ...
-
bioRxiv - Neuroscience 2022Quote: ... An adeno-associated virus (AAV) solution expressing the CaMPARI2 sensor (hsyn-NES-his-CaMPARI2-WPRE-SV40, Addgene catalog number 101060) was injected into two locations ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... A virus lacking the hM4Di DREADD gene and only containing the green fluorescent tag eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene) was also infused into OFC in separate groups of animals as a null virus control ...
-
bioRxiv - Neuroscience 2023Quote: ... A virus lacking the hM4Di DREADD gene and instead containing the fluorescent tag eGFP (AAV8-CaMKIIa-EGFP, packaged by Addgene) was infused into ACC in 4 animals as a null virus control ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611; http://n2t.net/ addgene:145611; RRID: Addgene_145611). pGBWm4046852 (coding for full- length nsp8 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584; http://n2t.net/ addgene:145584; RRID: Addgene_145584). The pET-28a-nsp9 gene was obtained from BEI Resources (NR-53501) ...
-
bioRxiv - Biochemistry 2020Quote: The MSP1E3D1 plasmid (with a His-tag as well as a TEV protease cleavage site, from Addgene, MA, USA) (26 ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human NDP52 cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_187829). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-NDP52 in E ...
-
bioRxiv - Cell Biology 2023Quote: ... we cloned human OPTN cDNA in a pETDuet-1 vector with an N-terminal 6×His tag followed by a TEV cleavage site (RRID:Addgene_190191). After the transformation of the pETDuet-1 vector encoding 6×His-TEV-mCherry-OPTN in E ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Molecular Biology 2020Quote: A pET28a vector with sub-cloned cDNA of Hsp53-(1-73) (72R) and the N-terminal His-tag was procured from Addgene, (plasmid #62082) ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584 ...
-
bioRxiv - Biochemistry 2020Quote: FUS LC and FUS LC 12E, soluble His-tag purifications as described (Monahan et al., 2017) (Addgene ID: 98653, 98654)