Labshake search
Citations for Addgene :
451 - 500 of 702 citations for Hepatitis B Virus Core Antigen HBcAg since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: Arachnoid cells were immortalized using a lentivirus harboring the SV40 large T antigen [pBABE-puro SV40 LT was a gift from Thomas Roberts (Addgene, RRID:Addgene_13970) as previously described (48) ...
-
bioRxiv - Molecular Biology 2022Quote: ... early passage primary MEFs from all genotypes were infected in parallel with the SV40 large T antigen (Addgene:13970) (Zhao et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... double inverted open (DIO)-reading frame adeno-associated virus (AAV): AAV5-hSyn-DIO-hM4D(Gi)-mCherry (Addgene; #44362) or AAV5-Ef1a-DIO-Cherry (UNC viral vector core ...
-
bioRxiv - Neuroscience 2020Quote: Recombinant adeno-associated virus carrying the GCaMP6f gene (AAV2/1:hSyn-GCaMP6f) was obtained from Addgene (100837-AAV1) with titer ≥ 1×1012 ...
-
bioRxiv - Neuroscience 2021Quote: ... 450nl of a mostly anterograde virus containing the Cre recombinase under CamKII promoter to target pyramidal cells (AAV1_CamKII_Cre_SV40, Addgene, USA) was injected into the right MEC (+3.2mm laterally from Lambda along the lambdoid suture and DV -2.5mm from skull level) ...
-
bioRxiv - Neuroscience 2020Quote: ... mice were injected with the virus encoding AAV9.CaMKII.GCaMP6f (pENN.AAV.CamKII.GCaMP6f.WPRE.SV40, gift from James M. Wilson, Addgene viral prep # 100834-AAV9) at the following coordinates ...
-
bioRxiv - Biochemistry 2021Quote: Tobacco Etch Virus protease (TEV) was a gift from Helena Berglund (Addgene plasmid # 125194; http://n2t.net/addgene:125194; RRID:Addgene_125194)40 ...
-
bioRxiv - Neuroscience 2022Quote: ... 100-200 nl virus solution of 3-5 × 1010 genome copies containing AAV5.gfaABC1d.Lck-GCaMP6f (Addgene, MA, USA) were injected at two or three sites in the craniotomy site at the cerebellar cortex (Vermis Lobule 4/5 ...
-
bioRxiv - Neuroscience 2023Quote: ... the Cre-dependent construct pAAV_hSyn1-SIO-stGtACR2-FusionRed packaged in an adeno-associated virus (AAV1, #105677-AAV1, Addgene) was injected into primary somatosensory cortex (S1 ...
-
bioRxiv - Neuroscience 2023Quote: ... Adeno-associated virus for expressing GcaMP7f or 8f under the synapsin-1 promoter (AAV1-syn-jGCaMP7f-WPRE; Addgene 104488 ...
-
bioRxiv - Neuroscience 2023Quote: ... we performed an additional control experiment in which we injected a cre-dependent mCherry virus (pAACV-hSyn-DIO-mCherry; a gift from Bryan Roth; Addgene plasmid #50459; http://n2t.net/addgene:50459; RRID:Addgene_50459) into the basal forebrain of 3 ChAT-cre mice ...
-
bioRxiv - Neuroscience 2024Quote: ... We injected in that region 3x750nL of an adeno-associated virus (AAV) mix of AAV1.Syn.GCaMP (6m: Addgene 100841 or 7f ...
-
bioRxiv - Developmental Biology 2020Quote: ... DBD and AD sequences along with the Drosophila synthetic minimal core promoter (DSCP) region were amplified using PCR from vectors pBPZpGal4DBDUw and pBPp65ADZpUw (Addgene clone 26234) using primers that added NotI and AvrII restriction sites (CTGATCGCGGCCGCAAAGTGGTGATAAACGGCCGGC and GATCAGCCTAGGGTGGATCTAAACGAGTTTTTAAGCAAACTCAC) ...
-
bioRxiv - Neuroscience 2021Quote: ... AAV9-hsyn-DIO- hsTRPA1-myc (GT3 Core at Salk Institute of Biological Studies) was injected at either 4E13 along with 1E12 AAV9-hsyn-DIO-GFP (Addgene #100043-AAV9) diluted in Hank’s Balance Salt Solution for injection ...
-
bioRxiv - Neuroscience 2019Quote: ... constructs from UNC Vector Core (Chapel Hill, NC) or Gi-coupled hM4Di DREADDs AAV8 (AAV8-DIO-hSyn-hM4Di-mCherry) (DREADDs-AAV) construct from Addgene (Cambridge, MA). The micropipette carrying the viral particles was first located above the AC at the left hemisphere at 1.5 mm anterior to lambda and just at the edge of the skull’s flat horizon ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 + 3 gRNAs targeting either side of the +3 kb enhancer core region (targeting sequences listed in Supplementary Table 2) were cloned into pX330 vector (Addgene plasmid #42230). mESCs were co-transfected with a mixture of all 6 CRISPR plasmids and a plasmid containing a blasticidin expression cassette for selection ...
-
bioRxiv - Neuroscience 2020Quote: ... each given at a total volume of 0.8 μl per hemisphere: 1) inhibitory Gi DREADD (AAV5-hSyn-hM4Di-mCherry; UNC Vector Core; n = 5; AAV8-hSyn-hM4Di-mCherry; Addgene; n = 5); excitatory Gq DREADD (AAV8-hSyn-hM3Gq-mCherry ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV9 ef1a-flex-Tdtomato viral vectors were purchased from the Canadian Neurophotonics Platform Viral Vector Core Facility (RRID:SCR_016477) and AAVrg-flex-Tdtomato was purchased from Addgene (viral prep: 28306-AAVrg). Retrogradely infecting AAVs were used for brain injections while AAV9 was used for intravitreal injections.
-
bioRxiv - Neuroscience 2023Quote: ... 150nl of AAV2-hSyn-DIO-hM3D(Gq)-mcherry or 150-600nl of AAV2-hSyn-DIO-mCherry (3×1012 vg/ml, 5.1×1012 vg/ml and 5.6×1012 vg/ml, respectively; Addgene and UNC Vector Core) into the MeA of Foxp2cre+/- mice ...
-
bioRxiv - Neuroscience 2022Quote: Pressure injections of AAV9 hSyn.jRGECO1a (totalling 0.5 × 1010 genomic copies in a volume not exceeding 200 nL, initially supplied by Penn Vector Core, PA, USA; and later by Addgene, MA, USA) and AAV2/5.GFAP.iGluSnFR.A184S (0.1 × 1010 genomic copies ...
-
bioRxiv - Neuroscience 2024Quote: ... packaged at UPenn Vector Core 2.5 × 1014 GC ml−1] and KORD [AAV8-HSyn-DIO-HA-KORD-IRES-mCitrine (Addgene plasmid no. 65417), packaged at UPenn Vector Core ...
-
bioRxiv - Biophysics 2021Quote: ... and immortalized by transduction with a retrovirus expressing SV40 T antigen from pBABE-puro SV40LT (pBABE-puro SV40LT was a gift from Thomas Roberts (Addgene plasmid # 13970 ...
-
bioRxiv - Biophysics 2023Quote: ... The DNA fragment encoding the T-cell-restricted intracellular antigen-1 (TIA-1) was digested from pFRT-TO-eGFP-TIA1 (#106094, Addgene) using Bsp1407I (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... Non-GFP expressing ZT cells were obtained by sorting out non-fluorescence ZT cells and they were subsequently immortalized by transfecting them with SV40 T-antigen expressing plasmid (Addgene).
-
bioRxiv - Cancer Biology 2024Quote: The chimeric antigen receptor against human CD276 (Du et al., 2019) and CD19 (Maude et al., 2018)together with the Thy1.1 surface antigen (Addgene 154194)(Umkehrer et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with mCherry – clathrin light chain B (Addgene Plasmid #55019) and EGFP – clathrin light chain A52 plasmids ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells expressing the Mis12-targeted Aurora B FRET sensor (Addgene, #45231) or photoactivatable GFP-α-tubulin (plasmid provided by Alexey Khodjakov ...
-
bioRxiv - Microbiology 2023Quote: ... pcDNA3.1-3xmyc-B-NLRC5 (Addgene plasmid #37509; http://n2t.net/addgene:37509; RRID:Addgene_37509), and pcDNA3.1-3xmyc-B-NLRC5 iso3 (Addgene plasmid #37510 ...
-
bioRxiv - Immunology 2023Quote: ... pcDNA3.3-SARS2-B.1.617.2 (Delta) was a gift from David Nemazee (Addgene plasmid #172320 ...
-
bioRxiv - Neuroscience 2021Quote: stGtACR2: 300 nL 1:10 AAV2/8-hSyn1-SIO-stGtACR2-FusionRed (working concentration 4.7*1011 gc/mL, Addgene/Janelia Viral Core, Ashburn, VA)
-
bioRxiv - Neuroscience 2020Quote: Stereotaxic injection of AAV-EF1a-DIO-HChR2(H134R)-eYFP (serotype 2/1 or 2/9, U. Penn Vector Core, Philadelphia, PA, USA or Addgene, Watertown, MA, USA) was performed in 6-8 weeks old DAT-IRES-Cre or FoxP2-Cre transgenic mice ...
-
bioRxiv - Neuroscience 2021Quote: The following AAV vectors were generated by the viral vector cores of Fukushima Medical University School of Medicine and Canadian Neurophotonics Platform by using the corresponding plasmids (Addgene #83896 and #83897) described in the original literature33.
-
bioRxiv - Neuroscience 2022Quote: ... we injected 300-500 nL of AAV5-CAG-Flex-GCamp6f-WPRE-SV40 (University of Pennsylvania Vector Core or Addgene, ∼8.75E+12 parts/mL) into the ACC at a depth of 1.5mm ...
-
bioRxiv - Neuroscience 2024Quote: ... and 80-100nl of either AAV5-hSyn-hChR2(H134R)-EYFP (UNC Vector core) or pAAV9-mDlx-ChR2-mCherry-Fishell-3 (Addgene viral prep # 83898) was injected into the right GPi or SNr ...
-
bioRxiv - Neuroscience 2024Quote: ... All rats received bilateral microinjections of AAV2.CMV::nNOS-shRNA-EGFP or AAV2.CMV::luciferase-shRNA-EGFP (USC viral vector core: titer∼∼7×1013 vg/mL) combined with an AAV2.CAG::Flex-Ruby2sm-Flag.WPRE.SV40 (Addgene: titer: ∼1×1012 vg/ml) into the NAc ...
-
bioRxiv - Microbiology 2020Quote: ... The plasmid used for constructing recombinant virus was pVSVΔG-eGFP (where eGFP is enhanced green fluorescent protein; plasmid 31842; Addgene). GPC was cloned into the ΔG site ...
-
bioRxiv - Neuroscience 2021Quote: ... the barcoded rabies virus plasmid library (131.36 mg) and CAG-promoter driven plasmids for T7 polymerase (23.66 mg, Addgene 59926) and SAD-B19 helper proteins (N ...
-
bioRxiv - Neuroscience 2021Quote: ... 200 nl of the adeno-associated virus (AAV) AAV1-SynGCaMP6s (diluted to 2.9×1012 GC/ml, Addgene 100844-AAV1) was injected into right motor cortex (1.6 mm lateral ...
-
bioRxiv - Neuroscience 2020Quote: ... hippocampal slice cultures were microinjected in the CA3 area with an adeno-associated virus (AAV7 or AAV9) to express either ChR2 ET-TC60 (RRID:Addgene_101361) or ChrimsonR61 (RRID:Addgene_59171 ...
-
bioRxiv - Neuroscience 2021Quote: ... Black-6 mice were first injected with 120nL of a retrograde virus encoding Cre (AAVrg-Ef1a-mCherry-IRES-Cre, titer of 1.37 x 10^13, Addgene viral prep # 55632-AAVrg ...
-
bioRxiv - Neuroscience 2019Quote: ... Virus injections per mouse pup were in a total volume of 4μL of AAV9-syn-GCaMP6s (Addgene, MA, USA) with a titer of 1Χ1013 vg/mL ...
-
bioRxiv - Cancer Biology 2019Quote: Brunello and Calabrese CRISPR guide virus libraries were obtained from the Broad Genomic Perturbation Platform (also available from Addgene). The pXPR_003 ...
-
bioRxiv - Microbiology 2020Quote: All virus-like particles were generated in HEK293T cells via calcium phosphate transfection using packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2020Quote: ... A pulled glass pipette front-loaded with virus carrying GCaMP6f (AAV1-hSyn-GCaMP6f-WPRE-SV40, 2.3 × 1013 gc/mL, catalog # 100837-AAV1, Addgene) was lowered into GC (1.9-2.0 mm below the dura ...
-
bioRxiv - Microbiology 2021Quote: ... vector pCMV-VSV-G for expression of the protein G from vesicular stomatitis virus (# 8454) were obtained from Addgene; reporter plasmids pUCHR-inLuc-mR and pUCHR-IR-GFP were described previously 37,38 ...
-
bioRxiv - Neuroscience 2022Quote: ... mice were injected with 100 nL of AAV virus expressing GCaMP6s into three locations within primary visual cortex (AAV1.Syn.GCaMP6f.WPRE.SV40; Addgene 100837-AAV1) at two depths (150 and 300 µm ...
-
bioRxiv - Neuroscience 2022Quote: ... Mice that were cre-positive received the AAV-hM3D injection (test mice) or a control virus AAV-YFP (Addgene) (control mice ...
-
bioRxiv - Neuroscience 2020Quote: ... we infected adult Brn3cCre mouse retinas with 1 ml Cre dependent AAV Virus (AAV2-CAG-FLEX-EGFP-WPRE, Addgene catalog # ...
-
bioRxiv - Neuroscience 2022Quote: ... 200nl of adeno-associated virus 2 (AAV2) containing either control construct (pAAV-hSyn-EGFP; plasmid #50465; Addgene, Watertown, MA) or excitatory DREADD (pAAV-hSyn-hM3D(Gq)-mCherry ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The viral vectors were generated by transfecting HEK293T cells using polyethylenimine with the packaging vector pCMV-dR8.91 and the vesicular stomatitis virus (VSV-G) envelope expression vector pMD2.G (#12259, Addgene) with either pLenti6.3/V5-DEST-TMPRSS2 (from UH Biomedicum Functional Genomic Unit ...