Labshake search
Citations for Addgene :
451 - 500 of 1994 citations for Heme oxygenase 1 HO 1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and pAAV2/1 (a gift from James M. Wilson, Addgene plasmid #112862 ...
-
bioRxiv - Cancer Biology 2024Quote: shRNAs and were cloned into pLko.1-puro (Addgene #8453) linearized with AgeI and EcoRI ...
-
bioRxiv - Cancer Biology 2024Quote: ... or an empty backbone pLKO.1 control (Addgene plasmid #8453) were used to generate virus and infect OVCAR3 cells or ID8 cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... The human TLR4 overexpression plasmid was purchased from Addgene (Cat. #13086). The T695A and T656A mutations were generated in WT-YME1L1 plasmid via QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... human ubiquitin C-driven CymR Cuo repressor purchased from Addgene (#119907) into pPig-Hygro transposase backbone from Max Wilson ...
-
bioRxiv - Cell Biology 2022Quote: ... tdmIRFP from Max Wilson and human GSK3β purchased from Addgene (# 16260) ORFs were supplied to VectorBuilder for cloning and EF1α-driven expression into 3rd generation lentiviral backbone ...
-
bioRxiv - Cell Biology 2019Quote: ... The human coding sequence for MYH10 gene was derived from Addgene plasmid ID# 11348 (Wei & Adelstein ...
-
bioRxiv - Biochemistry 2021Quote: ... pLenti CMV/TO Zeocin DEST with either human XBP1s insert (Addgene), and pLenti CMV hygromycin DEST with a DHFR.ATF6(1-373 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Plasmids encoding wild-type human RAB11 (#12679) was obtained from Addgene. The following primer sets were used for site directed mutagenesis:
-
bioRxiv - Cancer Biology 2020Quote: Human Tks5α was cloned into pCDH-CMV-MCS-EF1-Puro (Addgene) with a GFP sequence fused at the C-terminus ...
-
bioRxiv - Microbiology 2020Quote: Human CRISPR knockout pooled library (Brunello) was obtained from Addgene (#73178). Human CRISPRi pooled library (Dolcetto ...
-
bioRxiv - Cell Biology 2021Quote: ... The following plasmids were used: pEGFP-N1 human cofilin (Addgene 50859) and td-Tomato-LifeAct 7 (Addgene 54528).
-
bioRxiv - Cell Biology 2020Quote: Human WT CXCR4 was acquired as a donor plasmid (#81957, Addgene) and recombined into a lentiviral destination vector (#25890 ...
-
bioRxiv - Cell Biology 2021Quote: The human GeCKO v2 library (2 plasmid system) (Addgene plasmid #1000000049) was amplified by electroporation using a Bio-Rad Gene Pulser II electroporation apparatus (Bio-Rad #165-2105 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and pCMV-VSV-G/pCMV-dR8.2 for human cell lines (Addgene plasmid #8454 ...
-
bioRxiv - Genomics 2022Quote: Human STARR-seq-ORI vector was obtained from Addgene (plasmid #99296). 8ug of STARR-seq plasmid was digested with 20uL AgeI-HF® (R3552 ...
-
bioRxiv - Biochemistry 2022Quote: ... The recombinant human PRKACA cDNA was obtained from Addgene (Plasmid #23495) and cloned into between BamHI and KpnI in pcDNA5 vector (Invitrogen) ...
-
bioRxiv - Biochemistry 2022Quote: The human CRISPR knockout pooled library Brunello was obtained from Addgene (a gift from David Root and John Doench ...
-
bioRxiv - Cell Biology 2020Quote: 100 ng of human sgRNA library Brunello in lentiCRISPRv2 (Addgene, #73179) was transformed into electrocompetent Endura cells (#60242 ...
-
bioRxiv - Developmental Biology 2019Quote: ... and HA-tagged human Snai1 (clone 31697) were purchased from Addgene. Full-length cDNA clones for human DDX3X (Accession ...
-
bioRxiv - Immunology 2019Quote: ... Human codon optimized cas9 DNA was obtained from (Addgene, Plasmid #41815). To generate the knockout cell lines ...
-
bioRxiv - Neuroscience 2020Quote: Human pcDNA3.1-CHRNA7-mGFP was a gift from Henry Lester (Addgene plasmid # 62629 ...
-
bioRxiv - Microbiology 2021Quote: ... The lentiviral vector expressing human ACE2 (Dr. Sonja Best, Addgene 154981) was used with the lentiviral packaging plasmid psPAX2 (Dr ...
-
bioRxiv - Immunology 2020Quote: GeCKO and Brunello whole-genome human libraries were acquired from Addgene. Smaller scale validation library was created by selecting the top 300 positive and 50 negative regulators from the Brunello screen and filtering for expression in Ramos cells ...
-
bioRxiv - Molecular Biology 2021Quote: ... and/or the mammalian expression vectors for human HNF4A2 (#31100, Addgene), LXRα (110) ...
-
bioRxiv - Microbiology 2023Quote: ... and Human Interferon-Stimulated Gene CRISPR Knockout pooled Library (#125753, Addgene) (OhAinle et al. ...
-
bioRxiv - Biophysics 2023Quote: Histidine-tagged human RAD52 FL (RAD52 FL) expression vector (pET15b; Addgene) was transformed in E ...
-
bioRxiv - Neuroscience 2023Quote: Human Htt-exon1-Q94 fragment from pTreTight-Htt94Q-CFP (Addgene, #23966) was cloned into pBlueScript SK+ (kind gift of Eva Brinkman ...
-
bioRxiv - Biochemistry 2022Quote: Monomeric EGFP was subcloned into vectors containing human AR (Addgene #29235) and AR-V7 (Addgene #86856 ...
-
bioRxiv - Microbiology 2023Quote: Human TREX1 sequences were derived from plasmid GFP-TREX1 (Addgene 27219) and TREX1-D18N (Addgene 27220).
-
bioRxiv - Cell Biology 2023Quote: Plasmid containing CDS sequences of human MCU were taken from Addgene and restriction digestion was performed ...
-
bioRxiv - Microbiology 2023Quote: ... The cDNA encoding human cGAS (NM_138441.3) was purchased from Addgene (#108674) and subcloned into pEGFP-C3 vector.
-
bioRxiv - Biochemistry 2023Quote: ... The human RTCB gene was inserted into the 438B (Addgene: 30115) plasmid and the 438-Rgfp (Addgene ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human DNMT1 plasmid was purchased from Addgene (#36939, Watertown, MA, USA) (Li et al. ...
-
bioRxiv - Immunology 2023Quote: Human CD86 C-terminally tagged with enhanced GFP (pCD86-EGFP, Addgene) was sub-cloned into a modified version of the MSCV2.2 retroviral plasmid in which the IRES-GFP cassette was removed ...
-
bioRxiv - Cancer Biology 2023Quote: Human GBM cells were transduced with the 7TGC (Addgene plasmid #24304), 7TGC-SFRP1 or 7TGC-Notum lentiviral vectors at a multiplicity of infection (MOI ...
-
bioRxiv - Cell Biology 2022Quote: ... GGAACAAGTTCAGTGAACTG, #3: TGCATGCTCACTGATAATGA), IFIH1 (#1: CTTGGACATAACAGCAACAT, #2: TGAGTTCCAAAATCTGACAT) or TLR3 (#1: ACGACTGATGCTCCGAAGGG, #2: ACTTACCTTCTGCTTGACAA, #3: GGAAATAAATGGGACCACCA) and control gRNAs (Addgene plasmid #51763, #51762 and #51760) were ligated into pLentiCRISPRv2 (Addgene plasmid # 52961 ...
-
bioRxiv - Neuroscience 2022Quote: ... rAAV2-retro-CMV-bGlo-iCre-GFP (made in house; 1.07×1012 GC ml-1; 17) and AAV2-hSyn-DIO-hM4D(Gi)-mCherry (Addgene #44362; 4.6×1012 GC ml-1; 19); chemogenetic non-projection specific inhibition experiments AAV8-hSyn-hM4D(Gi)-mCherry (Addgene #50475 ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Molecular Biology 2020Quote: ... The following ORF24 fragments: residues 1-201 (ORF24-NTD) (Addgene #138420), residues 1-271 (Addgene #138421) ...
-
bioRxiv - Developmental Biology 2020Quote: ... A control PLKO.1 vector containing a scrambled shRNA (Addgene 1864) was used as a control ...
-
bioRxiv - Cell Biology 2019Quote: ... PX458 or PX458 containing gRNA and PLKO.1-puro (Addgene, #10878), were co-transfected into MEFs ...
-
bioRxiv - Biochemistry 2019Quote: The pLKO.1-puro empty vector was purchased from Addgene (#8453). A scrambled shRNA control and gene-specific shRNAs were designed through RNAi Central (http://cancan.cshl.edu/RNAi_central/step2.cgi) ...
-
bioRxiv - Neuroscience 2020Quote: ... AAVrg-Ef1α-mCherry-IRES-Cre (Titer ≥ 7×1012 vg.mL−1, Addgene). Cholera Toxin Subunit B (Recombinant) ...
-
bioRxiv - Neuroscience 2020Quote: rAAV5-hSyn-hChR2(H134R)-eYFP (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-hSyn-Jaws-KGC-GFP-ER2 (Titer ≥ 3.8×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... rAAV5-hSyn-hChR2(H134R)-mCherry (Titer ≥ 7×1012 vg.mL−1, Addgene), rAAV5-Ef1α-DIO-hChR2(H134R)-eYFP (Titer ≥ 4.2×1012 vg.mL−1 ...
-
bioRxiv - Neuroscience 2020Quote: ... A pLKO.1-TRC vector (a gift from David Root; Addgene plasmid #10879 ...
-
bioRxiv - Microbiology 2021Quote: ... Expression vectors for SARS-CoV-2 Wuhan-Hu-1 (Addgene, #149539), SARS-CoV-2 B.1.167.2 (Addgene ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... or negative control annealed oligo was inserted into pLKO.1 (Addgene) (Stewart et al ...
-
bioRxiv - Neuroscience 2020Quote: ... pLKO.1-TSC2 was a gift from Do-Hyung Kim (Addgene plasmid # 15478 ...