Labshake search
Citations for Addgene :
551 - 600 of 2782 citations for HLA A*0201 WT 1 complex Protein Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... adult DRG neurons from Twitcher and WT mice were isolated as described above and nucleofected with a plasmid encoding pEGFP-eEB3 (Addgene #190164). After transfection ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids expressing GST-tagged WT Dynamin 2 or Dynamin 2 ΔPRD were constructed using the Takara Biosciences In-Fusion system and a plasmid encoding rat WT Dynamin 2 (Addgene 34684) as a template ...
-
bioRxiv - Cell Biology 2022Quote: ... having N of human coronavirus OC43 and pGBW-m4134901 (plasmid number 151922) having N of human coronavirus HKU1 229E were obtained from Addgene. Those N expression vectors were subcloned into pcDNA3.1 with C-terminal flag or EGFP tag ...
-
bioRxiv - Cancer Biology 2022Quote: ... encoding human KDM6A with HA tag and pCS2-UTX-F-MT2 (40619) encoding enzyme-dead human KDM6A were purchased from Addgene. The HR and NHEJ reporter plasmids were kind gifts from Tomasz Skorski (61) ...
-
bioRxiv - Cancer Biology 2021Quote: The human MYC cDNA was purchased from Addgene (pDONR223_MYC_WT ...
-
bioRxiv - Molecular Biology 2019Quote: ... and a human codon-optimized Cas9 (Addgene 41815) were co-nucleofected into target cells by nucleofection (Lonza apparatus) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human ETV1 (Addgene, Cambridge, MA, USA; plasmid #82209) and ETV5 (Horizon Discovery ...
-
bioRxiv - Biochemistry 2020Quote: Plasmids encoding human full-length WDR5 (2GNQ, Addgene) or a 20aa N-terminal truncation (ΔN20 ...
-
Nonsense Mediated RNA Decay Is a Unique Vulnerability of Cancer Cells with SF3B1 and U2AF1 MutationsbioRxiv - Cell Biology 2021Quote: Human GeCKOv2 CRISPR knockout pooled library (Addgene # 1000000049) and lenti-Cas9 plasmid were obtained from addgene (Addgene # 52962) ...
-
bioRxiv - Cancer Biology 2021Quote: ... human TERT (LOX-TERT-iresTK; Addgene plasmid #12245), generously provided by Didier Trono ...
-
bioRxiv - Neuroscience 2022Quote: ... Human VAC14 was obtained from Addgene (Plasmid #47418) and subcloned into the mCherry- C1 vector ...
-
bioRxiv - Biochemistry 2022Quote: ... Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) was cloned in pET15b with N-terminal 6xHis and C-terminal StrepII tags ...
-
bioRxiv - Microbiology 2023Quote: The human SAM CRISPRa sgRNA library (Addgene #1000000078) was cloned into the pHW-TRPPC-NS rescue plasmid backbone for PR8 (Fig S2A ...
-
bioRxiv - Biophysics 2023Quote: Human MeCP2 in the pTXB1 plasmid (Addgene #48091) was propagated in E ...
-
bioRxiv - Immunology 2023Quote: A lentiviral construct containing human ACE2 (Addgene 155295) or mScarlet (Addgene 85044 ...
-
bioRxiv - Physiology 2023Quote: ... containing human Fis1 gene were purchased from Addgene. The working viral vectors were constructed from these two plasmids by Custom DNA Constructs ...
-
bioRxiv - Biochemistry 2023Quote: Human BIN1-EGFP (isoform 8) (Addgene plasmid #27305) and human dynamin2 C-terminally tagged to mCherry were cloned in pET15b with an N-terminal 6xHis and a C-terminal StrepII tag ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Neuroscience 2021Quote: ... HEK293 cells were co-transfected with plasmids encoding wide-type myc-human TREM2 and GFP-human TDP-43 (residues 216-414, Addgene, 28197) or GFP control by the calcium phosphate precipitation method ...
-
bioRxiv - Genetics 2020Quote: sgRNA sequences targeting human USP15 were selected from the Human Brunello CRISPR knockout pooled library (Doench et al., 2016)(Addgene #73178) and further selected on the basis of high quality score in two additional online tools ...
-
bioRxiv - Cancer Biology 2021Quote: ... we amplified human KEAP1 and LKB1 off of human cDNA and used Gibson assembly to replace GFP in pMCB306 (Addgene #89360) with these sequences ...
-
bioRxiv - Biophysics 2024Quote: Human RING1b (Uniprot ID Q99496) and human BMI1 (Uniprot ID P35226) were cloned into a pFBOH-mhl vector (Addgene plasmid # 62304) cleaved with BseRI using Gibson Assembly® Master Mix (NEB #E2611L ...
-
bioRxiv - Biophysics 2022Quote: HEK 293T cells were co-transfected with either pmNG-Mpro-Nter-auto-NLuc or pmNG-Mpro-Nter-auto-L-NLuc plasmid along with either pLVX-EF1alpha-SARS-CoV-2-nsp5-2xStrep-IRES-Puro (Mpro WT) (Addgene plasmid # 141370) or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A ...
-
bioRxiv - Cell Biology 2019Quote: ... Plasmids encoding Cypet (pCypet-Rac1(WT), #22782) and Ypet (pYpet-PBD, #22781) sequences were taken from the Addgene repository (Addgene Inc., USA) and subcloned into worm expression plasmids as mentioned above ...
-
bioRxiv - Cell Biology 2020Quote: ... PA28γ ORF WT or minus the C-terminal 14 amino acids (ΔC) were cloned into pSBbi-Pur (a gift from E. Addgene plasmid #60523) according to (Kowarz et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The Arf6-mCherry plasmid pcDNA3/hArf6(WT)-mCherry was a gift from Kazuhisa Nakayama (Addgene plasmid # 79422; http://n2t.net/addgene:79422; RRID:Addgene_79422; Makyio et al., 2012) and the sequence was confirmed using standard CMV-For and BGH-Rev primers ...
-
bioRxiv - Cell Biology 2020Quote: ... CRISPR-edited HaCaT BACH1-KO and HaCaT NRF2-KO/BACH1-KO cells were generated by transfecting either HaCaT WT or HaCaT NRF2-KO cells with two different pLentiCRISPR-v2 (a gift from Dr Feng Zhang, Addgene plasmid #52961) containing each one a guide RNA against the first exon and the second exon of BACH1 ...
-
bioRxiv - Cell Biology 2022Quote: ... VN-Tau (wt) was a gift from Tiago Outeiro (Addgene plasmid no. 87368; http://n2t.net/addgene:87368; RRID:Addgene_87368; (Blum et al., 2015). Tau (wt)-VC was a gift from Tiago Outeiro (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2022Quote: ... Tau (wt)-VC was a gift from Tiago Outeiro (Addgene plasmid no. 87369; http://n2t.net/addgene:87369; RRID:Addgene_87369; (Blum et al., 2015). pRK5-EGFP-Tau AP was a gift from Karen Ashe (Addgene plasmid no ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: pBABEpuro-HA-MEK1 (#49328), pMM9-MAPKK2-WT (MEK2, #40805), pFLAG-CMV-hERK1 (#49328), pHAGE-MAPK1 (ERK2, #116760) were purchased from Addgene (MA, USA). Point mutations were introduced using Q5 DNA polymerase to generate the ERK1C178A ...
-
bioRxiv - Cell Biology 2019Quote: Constructs used to rescue SHP2 knockout U2OS cells were obtained by cloning the SHP2 cDNA from pCMV-SHP2-WT (Addgene plasmid # 8381) into the migR1-IRES-GFP vector (Addgene plasmid # 27490) ...
-
bioRxiv - Genetics 2021Quote: RPA1 expression constructs were generated as derivatives of a RPA1-WT expression construct pLX304-hRPA1 bearing bearing an N-ter V5 tag (Addgene Plasmid #25890). The R41E ...
-
bioRxiv - Neuroscience 2023Quote: Two-cell-stage embryos were bilaterally injected with 400 pg human EEA1 tagged to GFP (GFP-EEA1 wt was a gift from Silvia Corvera; Addgene plasmid # 42307; http://n2t.net/addgene:42307; RRID:Addgene_42307; 54, subcloned into pcs2+), 200 pg membrane-mCherry mRNA (pCS-memb-mCherry was a gift from Sean Megason ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5’ and 3’ fragments containing incorporated mutated gene ORF sequences were amplified by PCR from the pDONR223-TP53 WT plasmid (Addgene; Plasmid #82754). In this case ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C- terminal TEV 6x-His tag was a gift from Ginkgo Bioworks (Addgene plasmid 145611 ...
-
bioRxiv - Biochemistry 2022Quote: ... with an initial Met and a cleavable C-terminal TEV 6x-His tag) was a gift from Ginkgo Bioworks (Addgene plasmid 145584 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The EcoRI-HpaI fragment of wild-type or mutant Claspin DNA from mAG-TEV-His-Claspin-Flag3 was inserted at the EcoRI/SnaBI site of pMX-IP (Addgene) to construct retroviral expression vectors ...
-
bioRxiv - Biochemistry 2020Quote: FUS LC and FUS LC 12E, soluble His-tag purifications as described (Monahan et al., 2017) (Addgene ID: 98653, 98654)
-
bioRxiv - Synthetic Biology 2021Quote: ... or Omphalotin A (OphA) genes with C-terminal His-tags were cloned into the UTR1-T7RNAP-T500 plasmid backbone (Catalog No. 67739, Addgene). The T7 Max promoter was further cloned into these plasmids for downstream experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... we added a signal peptide at the N-terminus of Breg and a 6×His tag at its C-terminus using pHL-sec vector (Addgene)39 ...
-
bioRxiv - Neuroscience 2022Quote: ... An adeno-associated virus (AAV) solution expressing the CaMPARI2 sensor (hsyn-NES-his-CaMPARI2-WPRE-SV40, Addgene catalog number 101060) was injected into two locations ...
-
bioRxiv - Cell Biology 2023Quote: ... The DNA fragment encoding integrin β4 was amplified from pcDNA3.1/Myc-His beta4 (a gift from Filippo Giancotti, Addgene #16039), and then inserted into the pEGFP-N1 vector for the expression of β4-GFP ...
-
bioRxiv - Cell Biology 2023Quote: ... Obtained pcDNA-Halo was further digested with HindIII/Bam-HI restriction enzymes and ligated with the NPM insert (obtained by PCR amplification from eGFP-NPM (17578 Addgene) with our primers 5’-CCCAAGCTTCCACCATGGAAGATTCGATGGACATGG-3’ and 5’-CGGGATCCAAGAGACTTCCTCCACTGCC-3’ ...
-
bioRxiv - Cancer Biology 2021Quote: ... KRT14 mouse and Human ShRNA sequence were cloned in the 3rd generation transfer plasmid pLKO.1 TRC cloning vector (Addgene cat # 10878) between unique AgeI and EcoRI restriction sites downstream of the U6 promoter ...
-
bioRxiv - Cell Biology 2022Quote: ... human APC open reading frame purchased from Addgene (#16507), tdmirfp670nano from Max Wilson ...
-
bioRxiv - Biochemistry 2020Quote: ... Human ACE2 plasmid was obtained from Addgene (#1786, (6)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the human ACE2 ORF was PCR amplified from Addgene plasmid 1786 and C-terminally fused with the porcine teschovirus-1-derived P2A cleavage sequence (ATNFSLLKQAGDVEENPGP ...
-
bioRxiv - Systems Biology 2021Quote: ... we used the human CRISPRi v2 library (Addgene #83969) (17) ...