Labshake search
Citations for Addgene :
1 - 50 of 830 citations for HIF 2 alpha Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... The HIF-1α construct was obtained from Addgene (Watertown, MA). Glucose uptake assay was performed with Glucose Uptake Cell-based Assay Kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2021Quote: ... and HA– HIF-1α was a gift from William Kaelin (Addgene plasmid 18955 ...
-
bioRxiv - Immunology 2021Quote: Recombinant SARS-CoV-2 HexaPro spike and RBD were produced from Addgene plasmid #154754 (50 ...
-
bioRxiv - Genetics 2024Quote: ... or the Alpha (Addgene # 170451), Beta (Addgene # 170449) ...
-
bioRxiv - Molecular Biology 2021Quote: ... and HA– HIF-1α was a gift from William Kaelin (Addgene plasmid 18955, RRID:Addgene_18955 [http://n2t.net/addgene:18955] ...
-
bioRxiv - Developmental Biology 2023Quote: ... or EGFP-alpha-Tubulin (Addgene #56450) and grown 24 hr ...
-
bioRxiv - Microbiology 2020Quote: ... miniSOG-Alpha-V-Integrin-25 (Addgene plasmid # 57763)51 and Beta1-GFP in pHcgreen donated by Martin Humphries (Addgene plasmid # 69804)52 ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366 ...
-
bioRxiv - Cancer Biology 2023Quote: ... To generate lentivirus for HIF mutants we subcloned HIF1α mutant from HA-HIF1α P402A/P564A-pcDNA3 (Addgene, 18955) into pCDH-CMV (Addgene ...
-
bioRxiv - Biophysics 2023Quote: The EGFP-alpha-synuclein gene was amplified from Addgene plasmid # 40822 (EGFP-alpha-synuclein-WT was a gift from David Rubinsztein (http://n2t.net/addgene:40822 ...
-
bioRxiv - Biochemistry 2020Quote: ... HA-HIF-1α was linearized with BamHI and had the clover gene amplified from the pcDNA3-Clover plasmid (Addgene #40259). To generate HA-Clover ...
-
bioRxiv - Cell Biology 2020Quote: ... Green fluorescent protein-tagged HIF-1α DM(P402/564A) was generated by inserting the sequence of Clover (Addgene plasmid #40259) behind the myc-tag in the BamHI-digested pCMV-Myc-HIF-1α DM(PP/AA ...
-
bioRxiv - Developmental Biology 2023Quote: ... sgRNA vectors targeting TTCACACATACAATGCACTG and GATGGTAAGCCTCATCACAG of the human HIF-1α gene (ENSG00000100644) were cloned into the pLH-spsgRNA2 vector (64114, Addgene). For GHRH-R activation ...
-
bioRxiv - Physiology 2024Quote: ... pLenti PGK Puro vectors expressing stable-HIF-11 (Plasmid #177202, addgene), pMD2.G (Plasmid #12259, addgene) and psPAX2 (Plasmid #12260, addgene) were ordered from Addgene.
-
bioRxiv - Cancer Biology 2023Quote: pVHL-stabilized HIF-2α (P405A/P531A) was amplified by PCR from the HA-HIF2alpha-P405A/P531A-pcDNA3 plasmid (Addgene, 18956) using primers BamHI-HIF2Af and AscI-HIF2Ar using NEB Q5 High-Fidelity 2X Master Mix according to the instructions of the manufacturer ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Molecular Biology 2019Quote: ... we modified the vector pET21a-alpha-synuclein (Addgene plasmid 51486) by introducing a 6x-histidine tag followed by a TEV cleavage site to the N-terminal of α-Syn ...
-
bioRxiv - Cell Biology 2022Quote: ... mCh-alpha-tubulin63 was a gift from Gia Voeltz (Addgene plasmid # 49149 ...
-
bioRxiv - Cell Biology 2023Quote: Plasmids encoding recombinant WT (RRID:Addgene_92100) and M880A mutant human GST-TAF3-PHD were kindly provided by Albert Jeltsch (Kungulovski et al. ...
-
bioRxiv - Immunology 2022Quote: ... for Alpha-S and pcDNA3.3-SARS2-B.1.617.2 (Addgene, no.172320) for Delta-S proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP-ROCK2 was a gift from Alpha Yap (Addgene plasmid # 101296)(88) ...
-
bioRxiv - Cell Biology 2020Quote: GFP-mROCK2 was a gift from Alpha Yap (Addgene plasmid # 101296). 500 ng of plasmid DNA was transfected into 1×105 hTERT RPE-1 cells in DMEM/F12 medium containing 10% fetal calf serum (FCS) ...
-
bioRxiv - Cell Biology 2021Quote: The pIRESneo-EGFP-alpha Tubulin plasmid was obtained from Addgene (USA) and mutation (Y224G ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mCherry-Alpha-Actinin-19 (Addgene #54975, gift from Michael Davidson), pCMV-mApple-MyosinIIA-N-18 (Addgene #54930 ...
-
bioRxiv - Biophysics 2022Quote: ... pCMV-mEmerald-Alpha-Actinin-19 (Addgene #53989, gift from Michael Davidson), pCMV-mCherry-Alpha-Actinin-19 (Addgene #54975 ...
-
bioRxiv - Cell Biology 2022Quote: ... The ORF of EPLIN isoform alpha was PCR amplified from Addgene plasmid #40928 to generate plasmid #1 ...
-
bioRxiv - Neuroscience 2019Quote: ... recombinant mouse E1 (Addgene plasmid # 32534), E2 (pGEX4T-1-UbcH5b) ...
-
bioRxiv - Biochemistry 2024Quote: Recombinant human GST-CK2α’ (Addgene #27084) and recombinant human GST-CK2α (Addgene #27083 ...
-
bioRxiv - Biochemistry 2019Quote: ... with Protein kinase A (M. musculus PKA catalytic subunit alpha; Addgene 14921) expressed with an N-terminal His tag ...
-
bioRxiv - Physiology 2019Quote: ... pSG5 PPAR alpha was a gift from Bruce Spiegelman (Addgene plasmid # 22751). FHRE-Luc was a gift from Michael Greenberg (Addgene plasmid # 1789) ...
-
bioRxiv - Microbiology 2022Quote: ... mCh-alpha-tubulin was a gift from Gia Voeltz (Addgene cat. 49149), while pcDNA-D1ER was a gift from Amy Palmer & Roger Tsien (Addgene cat ...
-
bioRxiv - Biochemistry 2022Quote: ... mCherry was PCR amplified from mCherry-Alpha-5-Integrin-12 (Addgene #54970) using forward primer 54970RMmCherryaddNHis_F2 ...
-
bioRxiv - Cell Biology 2021Quote: mApple-Alpha-5-Integrin-12 was a gift from Michael Davidson (Addgene plasmid # 54864 ...
-
bioRxiv - Cell Biology 2023Quote: ... and GFP-AHPH-DM (a gift from Alpha Yap, Addgene plasmid # 71368) were subcloned using following primers to create Gateway attB PCR products ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant strains harbouring pTEC19 plasmid (Addgene, #30178) and producing the fluorescent protein E2-Crimson were grown in Middlebrook 7H9 broth supplemented with 0.2% glycerol (v/v ...
-
bioRxiv - Biochemistry 2023Quote: ... and YFP tagged recombinant proteins (Addgene #173080), genes were inserted between N-terminal 6x His-tag followed by CFP/YFP tag and a TEV protease cleavage site of pNIC28-Bsa4 ...
-
bioRxiv - Biochemistry 2024Quote: ... and recombinant human GST-CK2α (Addgene #27083) enzymes were produced in-house as previously described [30] ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... employing the construct pIRESneo-EGFP-alpha Tubulin (a gift from Patricia Wadsworth; Addgene plasmid #12298 ...
-
bioRxiv - Cancer Biology 2024Quote: ... the mApple-Alpha-V-Integrin-25 was a gift from Michael Davidson (Addgene plasmid # 54866 ...
-
bioRxiv - Molecular Biology 2020Quote: ... and pCMV4-3 HA/IkB-alpha was a gift from Warner Greene (Addgene, #21985). To generate firefly luciferase (Fluc)-expressing vector (pNL1.1.PGK[Fluc/PGK] ...
-
bioRxiv - Physiology 2019Quote: ... pcDNA4 myc PGC-1 alpha was a gift from Toren Finkel (Addgene plasmid # 10974). pSG5 PPAR alpha was a gift from Bruce Spiegelman (Addgene plasmid # 22751) ...
-
bioRxiv - Biochemistry 2021Quote: ... HA-HIF1-alpha-pcDNA3 was a gift from William Kaelin (Addgene plasmid # 18949 [50]). pcDNA3 LATS1 was a gift from Erich Nigg (Addgene plasmid # 41156 ...
-
bioRxiv - Cancer Biology 2023Quote: Full length murine Tnf was PCR amplified from GFP-TNF-alpha plasmid (Addgene #28089) via Phusion PCR according to manufacturer’s protocol with the following primer ...
-
Intra-mitochondrial proteostasis is directly coupled to alpha-synuclein and Amyloid β 1-42 pathologybioRxiv - Neuroscience 2020Quote: ... Alpha-synuclein-EYFP was then cloned into the pLJM1 backbone for lentiviral expression (Addgene: 19319) (68) ...
-
bioRxiv - Physiology 2021Quote: ... The alpha myosin heavy chain/puro rex/neo was a gift from Mark Mercola (Addgene plasmid #21230 ...
-
bioRxiv - Developmental Biology 2022Quote: αBTX mRNA was synthesized from the Pmtb-t7-alpha-bungarotoxin vector (Megason lab, Addgene, 69542) as described in Swinburne et al ...
-
bioRxiv - Cell Biology 2023Quote: ... which was a gift from Alpha Yap (Addgene plasmid # 71366; http://n2t.net/addgene:71366; RRID:Addgene_71366) (Han et al. ...
-
bioRxiv - Microbiology 2023Quote: ... The pET21a-alpha-synuclein was obtained from Michael J Fox Foundation MJFF (Addgene plasmid # 51486) as a kind gift ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant plasmid containing human ACE2 gene (Addgene #1786) was transfected into HEK293T cells using Lipofectamine 2000 Transfection Reagent (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: Full-length recombinant human WT α-syn (Addgene #213498), α-syn 1-95 (Addgene #213499) ...