Labshake search
Citations for Addgene :
101 - 150 of 455 citations for Granzyme D GZMD Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... coli MG1655 into a His-SUMO-TEV (HST) plasmid backbone (Addgene product number: 48313). Each HST construct was grown in LB to an OD600 of 0.4 at 37°C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... C-terminal His-tagged eGFP plasmid was from our lab stock (Addgene, No. 178422)32 ...
-
bioRxiv - Cell Biology 2023Quote: ... purified from bacteria cells transformed with the plasmid pET-28b-RfxCas13d-His (Addgene 141322), was kindly provided by JP Concordet ...
-
bioRxiv - Biochemistry 2023Quote: GST-HRAS and His/MBP-KRAS were purchased from Addgene (#55653 and # 159546, respectively). GST-KRAS was created with standard Gibson Assembly (NEB ...
-
bioRxiv - Cancer Biology 2020Quote: ... HEK293/T17 cells were transfected with DNAJB1-PRKACA K128H plasmid along with psPAX2 (Addgene plasmid #12260, gift from Didier Trono) and pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Cell Biology 2021Quote: Rhodopsin protein was expressed in HEK293 cells using transient transfection (pcDNA3 rod opsin construct, a gift from Robert Lucas (Addgene plasmid # 109361 ...
-
YAP promotes cell-autonomous immune responses to tackle intracellular Staphylococcus aureus in vitrobioRxiv - Cell Biology 2022Quote: HEK293 cells were transfected in 96-well plates with the 8xGTIIC-luciferase plasmid (firefly luciferase, # 34615, Addgene, Watertown, MA, US) and the pRL-SVl40P plasmid (Renilla luciferase ...
-
bioRxiv - Physiology 2019Quote: ... pLKO.1 scrambled shRNA or Sirt4 shRNA was transfected in HEK293 T cells with packaging plasmids pMD2.G (Addgene plasmid # 12259) and psPAX2 (Addgene plasmid # 12260) ...
-
bioRxiv - Neuroscience 2021Quote: HEK293 cells were transfected with 500 ng of equimolar pooled SCN1A_h1b sgRNAs (Table 4) and 500 ng dCas9p300Core (Addgene, plasmid #61357) using Lipofectamine 3000 ...
-
bioRxiv - Cell Biology 2021Quote: ... Real time analysis of NFAT4-GFP nuclear translocation in response to 10 µM Cch stimulation was calculated using the equation: Quantification of ER Ca2+ store depletion and refilling was measured by transfecting parental and MCU-KO HEK293 cells with red R-CEPIA1er (Addgene: #58216) using Lipofectamine 24 hrs prior to imaging ...
-
bioRxiv - Microbiology 2020Quote: ... Plasmids were then linearized with MluI and 2μg of plasmid was transfected into 5×105 HEK293 cells together with a plasmid encoding the T7 polymerase 63 (Addgene 65974) using calcium phosphate ...
-
bioRxiv - Cancer Biology 2023Quote: ... integrating lentivirus for both Cas9 and sgRNA was generated by overnight transfection of adherent HEK293 cells with either the Cas9 or sgRNA vector and the packaging vectors psPax (Addgene #1226) and pMD2g (Addgene #12259) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Lentiviral particles containing the CD19 CAR element were produced by lipofectamine-based co-transfection of HEK293 cells with 3rd generation packaging plasmids pMD2.G (Addgene, #12259), pMDLg/pRRE (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... pAAV_hsyn_NES-his-CAMPARI2-F391W-WPRE-SV40 was a gift from Eric Schreiter (Addgene plasmid # 101061)31 ...
-
bioRxiv - Molecular Biology 2020Quote: ... His-tagged wild-type and D135S AlkB plasmids were obtained from Addgene (#79050 and #79051) and proteins were purified by a Ni-NTA column followed by cation exchange ...
-
bioRxiv - Bioengineering 2021Quote: ... We created 2 bacterial expression vectors: pET28-His-MBP-NLS-RfxCas13d-NLS-HA (Addgene 171586) produces the protein RfxCas13d-sTag after cleavage of the N-terminal His-MBP fusion partner ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: A plasmid encoding obligate dimeric TGT was cloned from the TGT-His plasmid (Addgene #138201) using DNA HiFi Assembly (New England Biolabs ...
-
bioRxiv - Molecular Biology 2021Quote: ... A1AT/ SERPINA1 and PAI1/ SERPINE1 cDNAs were amplified from SERPINA-bio-His plasmid (Addgene #52182) and SERPINE1-bio-his (Addgene #52077 ...
-
bioRxiv - Molecular Biology 2020Quote: ... strains of interest were transformed with a plasmid containing His-tagged SUMO (Smt3-Hisx7) (Addgene) under the control of a copper inducible promoter ...
-
bioRxiv - Cell Biology 2021Quote: ... from the pcDNA3.1 Flag-His-ATM plasmid (kind gift of Michael Kastan; Addgene plasmid #31985) (67 ...
-
bioRxiv - Microbiology 2022Quote: ... 500 ml LB culture of pCDFDuet-1-6×His-SARS-CoV-2-NSP7/NSP8 (Addgene)-transformed E.coli BL21 DE3 strain was induced by isopropyl β-d-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Pathology 2024Quote: ... BL21(DE3)-RIL Escherichia coli cells were transformed with pJ4M-TDP43-MBP-His (Addgene 104480) and grown on LB/Kanamycin/Chloramphenicol plates then used to inoculate 2L of TB/Kan/Cam/2g dextrose ...
-
bioRxiv - Neuroscience 2023Quote: ... and the injections of AAV5-hSyn-NES-his-CaMPARI2-WPRE-SV40 (2.5x10^12gc/ml Addgene 200nl measured using a Nano Injector ...
-
bioRxiv - Biochemistry 2022Quote: ... For transient HER2 overexpression in HEK293 cells, the cells were transfected with a plasmid encoding human HER2 wildtype (Li et al., 2004)(Addgene plasmid #16257) the day before measurement with removal of the transfection reagent after 6 hours ...
-
bioRxiv - Genomics 2023Quote: Plasmids in the pCAG backbone used to overexpress TWIST1 and ALX4 in HEK293 cells were cloned by digesting the pCAG-NLS-HA-Bxb1 plasmid (Addgene plasmid # 51271) prepared from dam-/dcm- E ...
-
bioRxiv - Biochemistry 2024Quote: ... Lentiviral particles were produced in HEK293 cells after transient transfection of the packaging vectors psPAX.2 and pMD.G2 (Addgene #12260 and #12259). After viral transduction ...
-
MANF regulates unfolded protein response and neuronal survival through its ER-located receptor IRE1αbioRxiv - Cell Biology 2020Quote: ... pEZYflag and pEZYmyc-His were a gift from Yu-Zhu Zhang (Addgene plasmids #18700 and #18701). Gateway destination vectors for BiFC for N- and C-terminal tagging with Venus fluorescent protein fragments (pEZY BiFC N NV ...
-
bioRxiv - Biochemistry 2021Quote: ... The His-Sumo bacterial version was codon optimized and cloned into K27-Sumo (Addgene ID 169193) via NEBuilder HiFi DNA Assembly Cloning Kit (NEB) ...
-
bioRxiv - Cell Biology 2021Quote: ... His-Strep2-tag from 438-SNAP-V3 vector a gift from Scott Gradia (Addgene plasmid # 55223) with inserting CATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCAT sequence right in front of Strep II gene by PCR primer ...
-
bioRxiv - Biochemistry 2020Quote: MBP-hnRNPA2 LC, soluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98661)
-
bioRxiv - Biophysics 2020Quote: ... overnight dialysis and subsequent Sumo-tag cleavage by human sumo protease (His-tagged SenP1; Addgene #16356) 44 were performed in 50 mM Tris/HCl ...
-
bioRxiv - Cell Biology 2019Quote: ... His-tagged SEPT5 plasmid was constructed by PCR amplifying SEPT5 from pCMV-Myc-tagged SEPT5 (Addgene plasmid # 27272 ...
-
bioRxiv - Synthetic Biology 2022Quote: A plasmid construct containing only the maturation protein and his-tagged coat protein dimer (Addgene # 179156) was transformed into Rosetta2™ (DE3 ...
-
bioRxiv - Biochemistry 2022Quote: ... coli and subcloned in-line with his-tagged MBP construct (2CT-10 vector, Addgene plasmid #55209). Recombinant MBP-EndoH fusion was expressed in and purified from E ...
-
bioRxiv - Cancer Biology 2023Quote: SULF2 ORF including C-terminal Myc-His tag was subcloned from its source vector (Addgene # 13003) to lentiviral transfer vector pHR-CMV-TetO2_3C-Twin-Strep (Addgene # 113883 ...
-
bioRxiv - Microbiology 2019Quote: ... The pUPRT::DHFR-D (Addgene, Cat#58528) plasmid backbone with PCR-amplification to remove the DHFR cassette was used to generate the construct for making the GRA45 complementation ...
-
bioRxiv - Cancer Biology 2021Quote: Lentiviral particles carrying a luciferase reporter were produced at the EPFL Gene Therapy Facility by transfecting HEK293 cells with the pHIV-Luc-ZsGreen plasmid (Addgene, Catalog No. 39196). Lentivirus-containing supernatants were collected and concentrated by centrifugation (1,500 g for 1 hr at 4°C) ...
-
Mediobasal hypothalamic FKBP51 acts as a molecular switch linking autophagy to whole-body metabolismbioRxiv - Neuroscience 2021Quote: ... A viral vector containing a Cre expressing cassette (pAAV-CMV-HI-eGFP-Cre-WPRE-SV40, Addgene; #105545) was used to induce Fkbp5 deletion in Fkbp5lox/lox mice ...
-
bioRxiv - Biophysics 2020Quote: ... Two plasmids containing full-length untagged Npl4 and C-terminal His-tagged Ufd1 were purchased from Addgene. Npl4 fragments were expressed in pET-28a vector with an N-terminal His-SUMO tag ...
-
bioRxiv - Biochemistry 2020Quote: hnRNPA2 LC (190-341), insoluble His-tag purification as described (Ryan et al., 2018) (Addgene ID: 98657)
-
bioRxiv - Biochemistry 2022Quote: AR-LBD (663-919) containing an N-terminal His-tag and encoded in pET15b plasmid (Addgene #89083) was expressed in Rosetta (DE3 ...
-
bioRxiv - Cell Biology 2022Quote: ... and PJ-DEAD (PJ-D) (Addgene plasmid # 38002) were gifts from Robin Irvine ...
-
bioRxiv - Neuroscience 2019Quote: ... Similar experiments were conducted using mammalian PSD-95 protein (prepared by transfecting expression vectors pCMV-PSD95-flag [FLAG-tagged; Addgene, #15463] into HEK293 cells) bound to GluN2B-peptide-containing Agarose resins ...
-
bioRxiv - Immunology 2021Quote: ... gene sequence was subcloned from pcDNA5/FRT/TO HIS HSPA1A (a gift from Harm Kampinga, Addgene plasmid # 19537; http://n2t.net/addgene:19537; RRID:Addgene_19537)(46 ...
-
bioRxiv - Biochemistry 2019Quote: ... pMAL-his-LbCpf1-EC was a gift from Jin-Soo Kim (Addgene plasmid # 79008; http://n2t.net/addgene:79008; RRID:Addgene_79008) (D ...
-
bioRxiv - Neuroscience 2020Quote: ... pEZYmyc-His (Addgene plasmid #18701; http://n2t.net/addgene:18702; RRID: Addgene_18701; a gift from Yu-Zhu Zhang [72]), that was digested with the same enzymes ...
-
bioRxiv - Biochemistry 2022Quote: Codon optimized plasmids encoding the individual His-tagged PBRM1 bromodomain constructs were received from Nicola Burgess-Brown (Addgene plasmid numbers 38999 ...
-
bioRxiv - Biophysics 2022Quote: ... GST-mCherry-FYVE (https://www.protocols.io/view/expression-and-purification-protocol-of-gst-mch-fy-b8k5ruy6) and His-TEV-ATG3 (Addgene_169079 ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757; http://n2t.net/addgene:70757; RRID:Addgene_70757) (69) ...