Labshake search
Citations for Addgene :
1 - 50 of 309 citations for Goat anti mouse HRP secondary antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Biochemistry 2020Quote: ... anti-mouse IgG AlexaFluor-488 (Life Technologies A11029-EA. The following plasmids were used: mouse PM20D1-flag (Addgene 84566). pENN.AAV.tMCK.PI.eGFP.WPRE.bGH (Addgene 105556) ...
-
bioRxiv - Neuroscience 2024Quote: ... and FSW-TM-HRP (Addgene #82540). The DNA was amplified using the PureLink™ Expi Endotoxin-Free Maxi Plasmid Purification Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... FSW-HRP-V5-LRRTM2 (Addgene #82537) and FSW-TM-HRP (Addgene #82540) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HrpS was amplified from pBW213 (Addgene 61435), HrpR was amplified from pBW115 (Addgene 61434) ...
-
bioRxiv - Neuroscience 2022Quote: ... and pAAV-EF1a-SYP-HRP (Addgene, #117185) were subcloned into pAAV-Syn-DIO-MCS that had multicloning sites (MCS ...
-
bioRxiv - Developmental Biology 2024Quote: ... and FSW-HRP-V5-LRRTM2 (Alice Ting, Addgene, #82537) plasmids ...
-
bioRxiv - Neuroscience 2024Quote: ... Alice Ting (Stanford University): FSW-HRP-V5-LRRTM1 (Addgene #82536), FSW-HRP-V5-LRRTM2 (Addgene #82537 ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse Pgc1b (Addgene1031) and mouse Esrra (Addgene 172152) were subcloned into pLenti IRES mApple vector for overexpression experiments ...
-
bioRxiv - Neuroscience 2022Quote: ... COX4-dAPEX2 and SYP-HRP derived from pAAV-EF1a-COX4-dAPEX2 (Addgene, #117176) and pAAV-EF1a-SYP-HRP (Addgene ...
-
bioRxiv - Molecular Biology 2020Quote: ... mouse TRIM21 (Addgene #105516) and CRY2Clust (Park et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... mouse Ebf1 cDNA (Addgene) was cloned into pLVX Tet-One Puro plasmid (Clontech) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... mouse Gqα15 (Addgene #40753) (Offermanns and Simon ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... mouse RIPK1 (Addgene #115341), and mouse RIPK3 (Addgene #78805 ...
-
bioRxiv - Cancer Biology 2024Quote: ... pMJ179 (mouse U6; RRID:Addgene_85996), pMJ117 (human U6 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and mouse RIPK3 (Addgene #78805) were cloned into apcDNA5/FRT/TO backbone (Invitrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... Mouse Kcnj2 was from Addgene plasmid 60598 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Mouse Ddx5 WT(Addgene plasmid #88869) and Lys144 to Asn mutant(Addgene plasmid #88870 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse IgG1 Fc (Addgene #28216) and IgG2a Fc (Addgene #114492) ...
-
bioRxiv - Neuroscience 2023Quote: ... pCDNA3-mouse PKA-RIalpha-mEGFP (Addgene plasmid # 45525 ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3-mouse PKA-RIbeta-mEGFP (Addgene plasmid # 45526 ...
-
bioRxiv - Genetics 2024Quote: ... Secondary nicking gRNAs were cloned into lentiGuide-Puro plasmid (Addgene cat# 52963). After digesting the lentiGuide-Puro plasmid with BsmBI-v2 the larger band on the gel was purified using Qiaquick Gel Extraction Kit ...
-
bioRxiv - Biochemistry 2024Quote: The coding sequences of mouse NL2 and mouse NRX1β were amplified from pNICE-NL2(-) (Addgene item #15246) and pNICE-LAP-neurexin-1β (Addgene item #42575) ...
-
bioRxiv - Immunology 2024Quote: gRNA targeting mouse Sppl3(mSppl3) or mouse Ugcg (mUgcg) were ligated into a lentiCRISPR-v2-GFP vector (Addgene) using BsmBI (New England Biolabs ...
-
bioRxiv - Developmental Biology 2021Quote: A mouse Cnr1 cDNA fragment (Addgene, #13391) was cloned into all-in-one tetracycline inducible plasmid (pAS4.1w.Ppuro-aON ...
-
bioRxiv - Cell Biology 2021Quote: ... and mCherry-Climp63(mouse) (Addgene plasmid #136293) were gifts from Gia Voeltz36 ...
-
bioRxiv - Neuroscience 2023Quote: ... and pCDNA3-mouse PKA-RIIalpha-mEGFP (Addgene plasmid # 45527 ...
-
bioRxiv - Genetics 2024Quote: To generate the B16F10 Capza3 KO lines the 2 CRISPR gRNAs enriched in the radiation alone and radiation and anti-PD1 antibody screen treatment conditions were cloned into the LRG vector (Addgene Plasmid # 65656). For WT controls a NTC gRNA from the CRISPR screen was cloned into the LRG vector ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ug of pooled library (Brunello Library Addgene #73178 or lab-cloned secondary library), 3 mL Opti-MEM ...
-
bioRxiv - Immunology 2022Quote: HEK293A cells stably expressing mouse NLRP3 (Addgene 75127), and ASC-GFP (Addgene 73957 ...
-
bioRxiv - Neuroscience 2021Quote: ... plus empty pEGFP and mouse neuroligin-1B (Addgene #15261 ...
-
bioRxiv - Cell Biology 2021Quote: ... The generation of mouse myc-Bnip3 (Addgene #100796) was described previously 48 ...
-
bioRxiv - Cell Biology 2022Quote: ... mouse GeCKOv2 CRISPR knockout pooled library (Addgene #1000000053,18), pMD2.G and psPAX2 were transfected into Lenti-X 293T cells ...
-
bioRxiv - Neuroscience 2024Quote: ... we used pD454-SR mouse alpha-synuclein (Addgene plasmid ...
-
bioRxiv - Cell Biology 2024Quote: A mouse PIEZO1-IRES-GFP plasmid (Addgene #80925) was used as the initial template to generate most of the constructs of the present work ...
-
bioRxiv - Biochemistry 2020Quote: ... To generate mec-4p∷hrp-1 mScarlet plasmids, mScarlet (Bindels et al., 2017) was amplified from pmScarlet_C1 (Addgene 85042) and assembled into hrp-1HsLCWT using NEBuilder HiFi DNA Assembly kit and introducing the D290V mutation by Quickchange ...
-
bioRxiv - Genetics 2021Quote: ... or the catalytic domain (CD) of mouse Dnmt3a and the C-terminal part of mouse Dnmt3L (3a3L) (amplified from pET28-Dnmt3a3L-sc27 (Addgene #71827)) and cloned in PiggyBac plasmids under control of the TRE3G promoter ...
-
bioRxiv - Developmental Biology 2021Quote: The mouse Trim41 cDNA (ENSMUST00000047145) tagged with PA and 1D4 was inserted under the control of the mouse Clgn promoter (Addgene #173686) (Ikawa et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... two independent sgRNA against mouse Chk2 (GTATACATAGAGGATCACAG and GCTGGAGACAGTGTCTACCC) or mouse Trp53 (56) were cloned into pKLV-U6gRNA(BbsI)-PGKpuro2ABFP (Addgene, 50946). Lentiviral packaging plasmids (1µg pCMV-Rev ...
-
bioRxiv - Molecular Biology 2023Quote: Polymerase chain reaction (PCR) was used to isolate mouse AMPKγ1 cDNA from a mouse AMPKγ1-HA vector (#40605, Addgene, Watertown, MA, USA). Mouse AMPKγ1 cDNA was then cloned into the 3xFLAG-CMV10 vector (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Snx9 (#27678) (all mouse) were from Addgene.
-
bioRxiv - Neuroscience 2020Quote: ... Postsynaptic mouse neuroligin-1 was PCR amplified from Addgene #15260 ...
-
bioRxiv - Genetics 2024Quote: Mouse CRISPR Brie lentiviral pooled library (Addgene Plasmid # 170511) consisting of 79,637 gRNAs was co-transfected with packaging plasmids (psPAX2 and pMD2.G ...
-
bioRxiv - Biophysics 2023Quote: ... mouse Opa1 sequence was cloned into pR26-CMVconst (Addgene plasmid #127373 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Lhx2 cDNA was amplified from TetO-FUW-Lhx2 (Addgene #61537 ...