Labshake search
Citations for Addgene :
551 - 600 of 1377 citations for Glyphosate Chemical Purity 96% 2 13C 99%; 15N 98%+ 1000 Ug Ml In Water since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... WPRE.SV40 virus (titer: 4 × 1013 GC per ml, obtained from Addgene) was lowered to a depth of 2.4 mm below the dura ...
-
bioRxiv - Neuroscience 2022Quote: ... and AAV2retro-syn-jGCaMP7f-WPRE (Addgene 104488, 1 × 1013 GC/ml) [1:1 mixture] ...
-
bioRxiv - Neuroscience 2022Quote: ... or AAV2retro-CaMKIIa-stGtACR2-FusionRed (Addgene 105669, 7 × 1012 VG/ml) were made unilaterally into right spinal cord gray matter at C7/C8 (0.5 mm lateral ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV-CAG-GFP (Addgene, 37825-AAVrg, 7.0×1012 vg/mL). In a subset of the brains ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV viruses were pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene, 105554-AAV1, 1.9×1013 vg/mL), AAV9-syn-RFP (SignaGen ...
-
bioRxiv - Neuroscience 2023Quote: ... and pAAV-hSyn-EGFP (Addgene, 50465-AAV1, 1.1×1013 vg/mL). In different brains ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus (AAV1.syn.jGCaMP7s.WPRE.SV40 from Addgene, lot v50167, titer 2.7E13 GC/mL) was then injected at 2 sites within the durotomy ...
-
bioRxiv - Systems Biology 2023Quote: ... we first digested mitochondrial matrix-localizing HyPer7 (pCS2+MLS-HyPer7, RRID:Addgene_136470) with BamH1 and XhoI and ligated into our lentiviral backbone (13) ...
-
bioRxiv - Neuroscience 2023Quote: ... AAVrg-hSyn-eGFP (RRID:Addgene_50465, 300 nl at 2x 1013 GC/ml) were injected into the pontine nuclei to regrogradely label PT neuron in the motor cortex ...
-
bioRxiv - Neuroscience 2023Quote: ... or AAVrg-hSyn-Cre (≥ 1.8 x 1013 vg/ml, Addgene # 105553) virus was bilaterally infused onto the iCA1 (AP-2.75 ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 1 CaMK2a-EYFP (1.0 × 1013 gp/mL) (Addgene #105622)
-
bioRxiv - Neuroscience 2023Quote: ... 7×10¹² genome copies per ml) viruses were purchased from Addgene.
-
bioRxiv - Neuroscience 2024Quote: ... or pAAV5-hSyn-DIO-hM3D(Gq)-mCherry (Addgene, 44361, vg/mL) were injected in Nav1.8 Cre animals in in the NTS (from bregma ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-GFP (Addgene 51502-AAVrg, titer; 2.3 x1013 pfu/ml), AAVrg-FLEX-jGCamp7s (Addgene 104491 ...
-
bioRxiv - Neuroscience 2024Quote: ... AAVrg-FLEX-GFP (Addgene 51502-AAVrg, titer > 1 × 1013 pfu/ml) was used as control.
-
bioRxiv - Cell Biology 2020Quote: ... inhibitor of growth protein-2 (ING2) cDNA was a gift from Curtis Harris (Addgene plasmid # 13294) (Pedeux et al ...
-
bioRxiv - Biophysics 2022Quote: ... or pLVX-EF1alpha-SARS-CoV-2-nsp5-C145A-2xStrep-IRES-Puro (Mpro C145A) (Addgene plasmid # 141371) plasmid in 96-well white flat bottom plates ...
-
bioRxiv - Immunology 2021Quote: ... with pcDNa3.1 vector expressing SARS-CoV-2 spike (BEI repository) and the helper plasmid pSPAX2 (Addgene). The VSV-G and empty lentiviruses were produced by replacing pCDNA3.1-Spike with pcDNA3.1-VSV-G or pCDNA3.1 empty vector ...
-
bioRxiv - Cell Biology 2022Quote: ... detailed in supplementary table 2) were designed using CHOPCHOP (https://chopchop.rc.fas.harvard.edu/) and cloned into pDD162 (Addgene). The sgRNA/Cas9 vectors were injected into adult C ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... All RVdG-CVS-N2c plasmids presented in this study are available from Addgene (Supplementary table 2).
-
bioRxiv - Biochemistry 2022Quote: ... pBBR1MCS-2 was a gift from Kenneth Peterson (Addgene plasmid # 85168; http://n2t.net/addgene:85168; RRID:Addgene_85168). The resulting plasmids were then transformed into Shewanella using electroporation (56) ...
-
bioRxiv - Neuroscience 2021Quote: ... The pCMV14-3X-Flag-SARS-CoV-2 S plasmid was a gift from Zhaohui Qian (Addgene plasmid # 145780 ...
-
bioRxiv - Microbiology 2021Quote: ... solution containing 2 μg of TF-responsive reporters driving Firefly luciferase (pGL3-3xAP1-luciferase (Addgene, 40342), pGL3-NF-κB-luciferase (Promega) ...
-
bioRxiv - Microbiology 2021Quote: ... pBMTL-2 was a gift from Ryan Gill (Addgene plasmid # 22812; http://n2t.net/addgene:22812; RRID:Addgene_22812). All amplification reactions were performed using Q5 high-fidelity DNA polymerase (New England Biolabs ...
-
bioRxiv - Cell Biology 2022Quote: ... Knock-ins were created by injecting pBS-KS-attB1-2 (Addgene#61255; (Zhang et al, 2014)) containing HA-tagged dAuxWT or HA-tagged dAuxRG (the R1119G mutation ...
-
bioRxiv - Genomics 2022Quote: ... 1-10 µg YAC/BAC payload DNA and 2-5 µg pCAG-iCre plasmid (Addgene #89573) per transfection ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV-mDlx-mCherry and pAAV-mDlx-tdTomato were generated using pAAV-mDlx-GCaMP6f-Fishell-2 (Addgene plasmid #83899 ...
-
bioRxiv - Immunology 2021Quote: ... Greene) and pCMV14-3X-Flag-SARS-CoV-2 S (a gift from Zhaohui Qian, Addgene #145780) at 1:0.5:2 molar ratio using Lipofectamine™ 2000 (0.6 ul per 1 ug DNA ...
-
bioRxiv - Immunology 2021Quote: ... Guide 1 (TGTTGGGGAACATATGACAC) and Guide 2 (AAGGAAAAATTCAAACAAGG) sequences were cloned into lentiGuide-puro plasmid (Addgene, #52963), transformed in Stbl3 bacteria (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... 2 × 104 HEK293T target cells transfected with 500 ng of a human ACE2 expression plasmid (Addgene) were seeded in a white flat-bottom 96-well plate one day prior to the assays ...
-
bioRxiv - Biophysics 2023Quote: Dendra-2 EEA1 was generated by replacing TagRFP-T in RagRFP-T EEA1 (Addgene plasmid #42635) at cloning sites AgeI and XhoI ...
-
bioRxiv - Biochemistry 2023Quote: ... SARS-CoV-2 Mac1 without CFP-tag was cloned and expressed from pNH-TrxT (Addgene #173084).
-
bioRxiv - Genetics 2023Quote: ... All the plasmids developed in this work (Table 2) will be available from Addgene (Massachusetts, USA) once the manuscript is accepted for publication.
-
bioRxiv - Immunology 2023Quote: ... SARS-CoV-2 whole spike protein HexaPro was a gift from Jason McLellan (Addgene plasmid # 154754). SARS-CoV-2 HexaPro was expressed in Expi293F cells and purified with Ni-NTA resin followed by size exclusion as described previously [61] ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vectors used included pGIPZ-GFP-Puro (see Supplementary Materials) and psPAX.2 and pMD2.G (Addgene). Cell transfections were done in Opti-MEM (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... Oligonucleotides were annealed and cloned in BsmBI–digested lentiCRISPRv.2-puro plasmid (catalogue no. 52961; Addgene). Lentiviral particles for cloned lentiCRISPRv.2 were generated by transfecting human embryonic kidney (HEK ...
-
bioRxiv - Genetics 2023Quote: pHarvester was generated using pCFD5-gRNA#1&2 and pnos-Cas9-nos plasmids (Addgene no: 62208). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Heterozygous ChAT-Cre mice were bilaterally injected with 1.0 µL of pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 (diluted 1:2 in dPBS; Addgene: 100845-AAV5) in basal forebrain (AP ...
-
bioRxiv - Microbiology 2024Quote: Mammalian expression vectors used were pcDNA3.1-Ha-Dynamin 2.WT (gift of S. Schmid; Addgene 34684), pcDNA3.1-Ha-Dynamin 2.K44A (gift of S ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µL of the adeno-associated viral vector rAAV9/1.EF1a.DIO.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, #20298-AAV9) was dyed with 0.3 µL fast green (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: The GeCKO V2 human library A and B containing 112417 sgRNAs targeting 19052 genes as well as 1000 nontargeting control sgRNAs was obtained from Addgene (Cat.# 1000000048 and 1000000049). Plasmid DNA was amplified and lentivirus was produced and amplified using HEK293FT cells following the provided protocol (51) ...
-
bioRxiv - Neuroscience 2021Quote: ... or AAV5-hSyn-DIO-hM4D(Gi)-mCherry (≥8 × 1012vg/mL, Addgene #44362). The needle remained in place for an additional 5 minutes after each injection to allow for diffusion of the virus and then the needle was slowly removed from the brain ...
-
bioRxiv - Neuroscience 2021Quote: AAV5-CamKIIa-hChR2 (H134R)-EYFP (titer: 1.5 × 1013 GC/ml, Addgene, 26969) was stereotaxically injected into S2 or M1 in mice aged 4-6 weeks ...
-
bioRxiv - Neuroscience 2021Quote: ... Addgene) or eYFP alone (AAV2-CaMKIIa-EYFP, 2.0 × 1012 Vg/mL, Addgene; AAV5-CaMKIIa-EYFP ...
-
bioRxiv - Neuroscience 2021Quote: ... and AAV1-Syn-FLEX-GCaMP6s (Addgene: 100845-AAV1, title: 2.5×1013vg/ml) was delivered into the dLGN of 6 wild type C57BL/6J mice (3 male ...
-
bioRxiv - Neuroscience 2021Quote: pAAV-CaMKIIa-eGFP (titer ≥ 3×1012 vg/mL, Addgene, catalog # 50469-AAV5) and pAAV5-CaMKII-hChR2(H134R)-eYFP-WPRE (titer ≥ 1×1013 vg/mL ...
-
bioRxiv - Neuroscience 2021Quote: - AAV1-hsyn1-SIO-stGtACR2-FusionRed (120-200nl, 0.9-1.8e12 GC/ml, Addgene) - for stGtACR2 inactivation
-
bioRxiv - Neuroscience 2020Quote: ... 7 mice) or AAV2-hSyn-DIO-mCherry (4.7 × 1012 particles/mL; Addgene, Catalog number 50459-AAV2 ...
-
bioRxiv - Neuroscience 2020Quote: ... or 400nl of AAV9-CaMKIIa.C1V1(t/t).TS.EYFP (≥1013 CG/ml, Addgene). Orexin promoter virus expression specificity has been characterized previously (González et al. ...