Labshake search
Citations for Addgene :
1 - 50 of 1994 citations for Flap endonuclease 1 FEN 1 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2019Quote: ... and human KIF1A (aa 1-393; Addgene # 61665). Tau-2N4R ...
-
bioRxiv - Cancer Biology 2023Quote: ... we used human decipher module 1 library (RRID:Addgene_28289)(Diehl et al ...
-
bioRxiv - Immunology 2021Quote: Human SHP-1 wt cDNA was obtained from Addgene. The cDNA of SHP-1 was subcloned into the expression vector pEYFP-N1(Clontech ...
-
bioRxiv - Neuroscience 2021Quote: ... co-expressing the Cas9 endonuclease and GFP (RRID: Addgene_48138). Low passage LUHMES cells were fed with fresh proliferating media 2h prior to transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... co-expressing the Cas9 endonuclease and GFP (RRID: Addgene_48138). Colonies of QOLG-1 wild-type parent hiPSCs were fed E8 2 hours prior to transfection ...
-
bioRxiv - Biophysics 2019Quote: ... human α-actinin 1 cDNA (Addgene; pEGFP-N1 alpha-actin1) was truncated at the actin binding domain (Asp1-Ala247) ...
-
bioRxiv - Cancer Biology 2023Quote: ... the murine shRNA hairpins pLKO.1-shCdkn2a #1 (TRCN0000077816) and #2 (TRCN0000362595) and the human and murine pLKO.1-shGFP control (Addgene, cat#30323) vectors were packaged using the ViraPower Kit (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... The Toronto human knockout pooled library (TKO) Version 1 (Addgene #1000000069) was a gift from Jason Moffat19.
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5 µg pCBASceI plasmid (I-SceI endonuclease expression vector) (Addgene, 26477) was transfected into cells via Lipofectamine 3000 for a further 48h before cells were harvested to run FACS ...
-
bioRxiv - Cancer Biology 2020Quote: ... human PML SUMO-1 mutant and GFP-BLM were purchased from Addgene (#62804 ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg; Addgene 50861), pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 WT (gift from James Bamburg; Addgene 50859), pEGFP-N1 human cofilin-1 S3E (gift from James Bamburg ...
-
bioRxiv - Cell Biology 2023Quote: ... pEGFP-N1 human cofilin-1 S3A (gift from James Bamburg; Addgene 50860) cofilin-1 (Garvalov et al. ...
-
bioRxiv - Genomics 2020Quote: ... Plasmids for human LINE-1 expression: pBS-L1PA1-CH-mneo (CMV-LINE-1) was a gift from Astrid Roy-Engel (Addgene plasmid # 51288 ...
-
bioRxiv - Microbiology 2023Quote: ... The human ANP32A 1-149 construct was a gift from Cynthia Wolberger (Addgene plasmid # 67241 ...
-
bioRxiv - Biochemistry 2022Quote: Human PARP6 (Uniprot #Q2NL67-1) was cloned into a modified pFASTBac1 vector (Addgene #30116) with N-terminal 6X His-maltose binding protein (MBP ...
-
bioRxiv - Neuroscience 2023Quote: ... human TDP-43M337V has subcloned into the pLenti CMV Puro DEST (W118-1, Addgene) plasmid as previously described (Zhang et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... using BamHI and EcoRI endonucleases and inserted into the pWPXL plasmid (Addgene ref #12257). To obtain the TFAM construct containing the 3’mitoUTR (3’mitoUTR_TFAM-mScarlet_pWPXL) ...
-
bioRxiv - Molecular Biology 2023Quote: ... an shRNA targeting human UNK gene was cloned in the pLKO.1 puro plasmid (Addgene_8453) between AgeI and EcoRI sites61 ...
-
bioRxiv - Cell Biology 2020Quote: ... pGEX6P1-human LIC1 G domain (GST-LIC 1-389) was a gift from Ron Vale (Addgene plasmid # 74598 ...
-
bioRxiv - Biophysics 2020Quote: The DNA of the human kinesin-1 variant devoid of cysteine residue-encoding codons (Addgene #24430) consisted of amino acids 1 to 560 of KIF5B encoding a C-terminal 6xHis-tag[41] ...
-
bioRxiv - Neuroscience 2023Quote: ... pcDNA3.1 Dynamin 1 (human, p880) was a gift from Sandra Schmid and was obtained from Addgene (Addgene plasmid #34682 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Human FUS (residues 1-214) was amplified by PCR using pHR-FUSN-mCh-Cry2WT (Addgene #101223). The IDRs fragments were fused with TPPPCORE domain(aa.45-166 ...
-
bioRxiv - Neuroscience 2021Quote: ... under the control of the human synapsin-1 gene promoter (AAV-GFP/Cre, 105540-AAV1, pENN.AAV1.hSyn.HI.eGFP-Cre.WPRE.SV40, Addgene, Massachusetts, USA) or with AAV expressing only GFP (AAV-GFP ...
-
bioRxiv - Cell Biology 2020Quote: Specific shRNA1 and shRNA2 targeting human ARID1A were cloned into the pLKO.1-TRC-puro vector (Addgene), separately ...
-
bioRxiv - Genetics 2020Quote: The plasmid that contains the isoform 1 of human DNMT3B (DNMT3B1) was purchased from Addgene (cat # 35522). The DNMT3B1 cDNA was then fused to an N-terminal Flag tag by PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... The pSpCas9(BB)-2A-GFP (PX458) vector expressing Cas9 endonuclease (gift from Feng Zhang, Addgene plasmid # 48138) was linked with a single-guide RNA (sgRNA ...
-
bioRxiv - Cell Biology 2023Quote: ... The PCR cassette was transfected into HeLa cells with a helper plasmid containing AsCas12a endonuclease (Addgene 89353). Following cleavage ...
-
bioRxiv - Immunology 2020Quote: Soluble human ACE2 with an Fc tag was constructed by PCR amplifying ACE2 (residues 1-615) from Addgene plasmid #1786 (a kind gift from Jesse Bloom ...
-
bioRxiv - Immunology 2022Quote: shRNAs were designed to target human Galectin-9 mRNA and cloned into the pLKO.1 vector (Addgene #10878). The sense shRNA sequences are CCTGGTGCAGAGCTCAGATTT (shGal-9 #1 ...
-
bioRxiv - Cancer Biology 2023Quote: Whole genome CRISPR Screening was performed using the Human CRISPR Knockout Pooled Library (Brunello) - 1 vector system (Addgene and a gift from John Doench to the Functional Genomics Facility at the University of Colorado Anschutz Medical Campus)(44) ...
-
bioRxiv - Neuroscience 2023Quote: The following expression constructs were used: human CaV2.2 (huCaV2.2 (pSAD442-1) was a gift from Diane Lipscombe (Addgene plasmid # 62574 ...
-
bioRxiv - Cell Biology 2022Quote: Human FL-RING1A (1–406aa) and CSD HP1β(80–185aa) were subcloned into bacterial expression 1GFP vector (Addgene #29663) and 1B vector (Addgene #29653) ...
-
bioRxiv - Microbiology 2020Quote: ... DNA encoding residues 1-177 of both human RAC1 and CDC42 were cloned into an unmodified pET-28a (Addgene) vector that encodes an N-terminal TEV-cleavable 6xHis-tag using the NdeI/XhoI sites ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.25 μL of F-ABM lentiviral mix (1:1:1:1 of Addgene plasmids 27150 ...
-
bioRxiv - Biochemistry 2020Quote: ... H-HCF-1) and full length human THAP11 cDNA with carboxy-terminal FLAG tag (Plasmid #28020; F-THAP11) were obtained from Addgene. Vectors containing full length human THAP1 cDNA with carboxy-terminal 1X FLAG tag (THAP1-F ...
-
bioRxiv - Cell Biology 2021Quote: ... The constitutively active form of kinesin-1 (human KIF5B, K560) was cloned by PCR from pet17-K560-GFP_His (Addgene, 15219) into pEGFP-N1 vector using EcoRI primer (104-5p EcoRI-K560 ...
-
bioRxiv - Cell Biology 2020Quote: ... and FLAG-tagged FL human TSC2 (1807 amino acids, UniProtKB/Swiss-Prot accession number P49815- 1) were purchased from Addgene, and pRK7 was subcloned with FLAG-tagged human TBC1D7 (293 amino acids ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... A human elongation factor 1 (EF1) promoter was introduced using a Gateway att4-att1 Entry clone (Addgene, Watertown, MA, #162920). Final expression clones were verified by restriction analysis and maxiprep DNA was prepared using the Qiaprep Maxiprep kit (Qiagen ...
-
bioRxiv - Cancer Biology 2023Quote: ... we designed single guide RNAs to target the exon 1 of the human Per2 gene and subcloned it into the PX459 vector (Addgene) to obtain the PX459-Per2 plasmid ...
-
bioRxiv - Genetics 2024Quote: ... pLenti-CMV-HA-HHIP lentiviral expression plasmid was generated by subcloning the appropriate human HHIP cDNA PCR fragment into pLenti-CMV Blast (659–1) (Addgene). HA-tag was inserted into human HHIP cDNA after Ala 23 ...
-
bioRxiv - Genomics 2020Quote: THP-1 and MV4;11 cells were engineered to stably express humanized S.pyogenes Cas9 endonuclease by lentiviral transduction with the FUCas9Cherry vector (Addgene 70182) and subsequent FACS-selection for mCherry-positive cells (THP-1-Cas9 ...
-
bioRxiv - Plant Biology 2021Quote: ... including a 2385 bp region upstream of the ATG start codon and a 294 bp region downstream of the TAG stop codon was PCR amplified with oligonucleotides MTOPVI-Prom-SalI-F and MTOPVI-Term-NotI-R and cloned between SalI and NotI restriction endonuclease sites into pGreen0029 vector (Addgene), to yield the pGreen-gMTOPVIB construct ...
-
bioRxiv - Cancer Biology 2022Quote: ... a central region containing a triple FLAG epitope and P2A-neomycin resistance cassette acquired via restriction endonuclease digestion of pFETCH_Donor (Addgene: 63934); and 3 ...
-
bioRxiv - Cell Biology 2023Quote: ... the cells were transfected with an I-SceI rare cutter endonuclease coding plasmid construct (cat #26477, Addgene Watertown, Massachusetts, USA). After 96 h of gene silencing ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tetracycline-inducible TET-shRB1 and constitutive shRB1 constructs were created by integrating validated siRNA sequences GAAAGGACATGTGAACTTA (63) and GAACGATTATCCATTCAAA (64) targeting human RB1 (shRB1) into TET-pLKO.1-Puro vector (Addgene #21915) and pLKO.1-Puro vector ...
-
bioRxiv - Cancer Biology 2021Quote: ... plasmids were created by integrating validated siRNA sequences CCTGTCAGGAAACTGTATGAT (62) and AATGGCCATCAGAACGGACTT targeting human ESRRG (shESRRG) into pLKO.1-Puro vector (Addgene #8453). Non-specific siRNA sequence AACAGCCACAACGTCTATATC or siRNA sequence CAACAGCCACAACGTCTATAT targeting GFP were used as controls for shRNA ...
-
bioRxiv - Cancer Biology 2022Quote: The human NOTCH 1 intracellular domain (h1NICD) doxycycline-inducible expression plasmid (pLIX-h1NICD) was a gift from Julien Sage (Addgene #91897)11 ...
-
bioRxiv - Bioengineering 2020Quote: ... Other CRISPR/Cas endonucleases (SaCas9, Cas12a and CjCas9) were subcloned from pX601-SaCas9 (kindly provided by Feng Zhang; Addgene No. 61591), pcDNA3.1-hAsCpf1 (kindly provided by Feng Zhang ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...