Labshake search
Citations for Addgene :
1 - 50 of 76 citations for FMOC L MEORN MTR OH since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: MTR knockout using CRISPR-Cas9 was accomplished using the pLenti-CRISPR v2 plasmid (Addgene Plasmid 49535)58 ...
-
bioRxiv - Cancer Biology 2020Quote: Generation of batch MTR knockout cells in each cell line was achieved using the lentiviral CRISPR–Cas9 vector system LentiCRISPR v2 (Addgene #52961). Briefly ...
-
bioRxiv - Neuroscience 2022Quote: ... The rAAV-pCAG-FLEX-EGFP-WPRE was a gift from Hongkui Zeng (Addgene plasmid #51502-AAVrg; RRID:Addgene_51502 (Oh et al., 2014)) and the rAAV-CAG-tdTomato (codon diversified ...
-
bioRxiv - Microbiology 2021Quote: ... and L (Addgene # 64085) recovery support plasmids (3:5:1 µg) ...
-
bioRxiv - Bioengineering 2024Quote: ... The Bclx(L) gene was amplified from pMIG Bcl-x(L) (Addgene Plasmid #8790) using the primers Bclx(L)-F (5’-ATTTGCGGCCGCACCATGTCTCAGAGCAACCG-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: ... p-hCathepsin L (Addgene #11250), pCSDest-HA-TMPRSS2 (Addgene #154963) ...
-
bioRxiv - Developmental Biology 2023Quote: ... AAVS1 TALEN-L (Addgene plasmid #59025) and AAVS1 TALEN-R (Addgene plasmid #59026 ...
-
bioRxiv - Molecular Biology 2023Quote: ... A HeLa H2B-mCherry EmGFP-NSD3-L cell line was generated by transfecting EmGFP-NSD3-L cells with a pH2B_mCherry_IRES_puro2 plasmid (Addgene #21045) as described above ...
-
bioRxiv - Genetics 2023Quote: ... 1.5 µg AAVS1 TALEN L (Addgene 59025) and 1.5 µg AAVS1 TALEN R (Addgene 59026 ...
-
bioRxiv - Microbiology 2020Quote: ZAP-L was obtained from Addgene (plasmid #45907). ZAP-CD was generated by using primers containing a Kozak sequence and an N-terminal HA tag ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 μg AAVS1-TALEN L plasmid (Addgene #59025), and 5mg donor plasmid (AAVS1 TREG EBdCas9 or AAVS1 TREG EBNCdCas9 ...
-
bioRxiv - Neuroscience 2024Quote: ... 13.9 μg of SAD B19-L (Addgene #32632), 16.6 μg of CAGGS-T7opt (Addgene #65974) ...
-
bioRxiv - Biochemistry 2022Quote: ... This was cloned into p15TV-L (AddGene ID: 26093) under the T7 promoter in-frame with the N-terminal 6xHisTag ...
-
bioRxiv - Genetics 2020Quote: ... and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Developmental Biology 2022Quote: ... pCXLE-L-MYC-F2A-LIN28 (ML, Addgene ID 27080), pCXLE-hOCT4-shTP53 (Addgene ID 27077) ...
-
bioRxiv - Systems Biology 2023Quote: ... and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Genetics 2023Quote: ... by co-transfecting cells with TALEN-L (Addgene #35431), TALEN-R (Addgene #35432 ...
-
bioRxiv - Neuroscience 2024Quote: ... containing AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837 (44)) and AAV9-CAMKII-mScarlet-C1V1-KV2.1 (Addgene ...
-
bioRxiv - Molecular Biology 2021Quote: ... Plasmid vector pHSP70-Cas9 (donated by L. B. Voshall, Addgene #45945) (Gratz et al. ...
-
bioRxiv - Neuroscience 2022Quote: TALENs (AAVS1-TALEN-L and AAVS1-TALEN-R; Addgene, 59025/59026)(Gonzalez et al. ...
-
bioRxiv - Microbiology 2023Quote: ... -L and -G-expressing plasmids (Addgene, 64087, 64088, 64085 and 8454), using TransIT-LT1 transfection reagent ...
-
bioRxiv - Synthetic Biology 2022Quote: ... PCR with pKD3 (pKD3 was a gift from Barry L. Wanner; Addgene plasmid #45604 ...
-
bioRxiv - Genetics 2023Quote: ... 2μg of both TALEN-L and TALEN-R plasmids (Addgene, #59025 and #59026) and 4µg of pUCM-AAVS1-TO-hNGN2 plasmid (Addgene ...
-
bioRxiv - Cancer Biology 2024Quote: ... and pBabe-puro-IRES-EGFP (a gift from L. Miguel Martins; Addgene #14430) as a control ...
-
bioRxiv - Bioengineering 2021Quote: ... with 1000 ng of reporter and 500 ng of each TALEN-L (Addgene #35431) and TALEN-R (Addgene #35432 ...
-
bioRxiv - Molecular Biology 2020Quote: ... pMXs-Hu-N-Myc and pMXs-Hu-L-Myc plasmids were obtained from Addgene. The pCCL-WSB1 and pCCL-c-Myc plasmids were purchased from Genscript ...
-
bioRxiv - Microbiology 2024Quote: ... such that gene could be inserted by Gibson Assembly into p15TV-L (Addgene #26093) linearized by BseRI digestion to produce the expression vector p15TVL-AcdA ...
-
bioRxiv - Genomics 2024Quote: ... 1000 ng of pJT039 and 500 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Immunology 2023Quote: ... whereas mCherry1-10-RNase L was inserted into pLenti-PGK-PuromycinR plasmid (Addgene: Plasmid #19070). The mRuby-OAS3 CDS and mRuby2 were amplified via PCR and primers (Supplemental table 1 ...
-
bioRxiv - Neuroscience 2023Quote: ... or GFP and Synaptophysin-RFP cDNA (pRVdG-N-P-M-EGFP-SynPhRFP-L, Addgene plasmid #52483), and with these additional plasmids ...
-
bioRxiv - Neuroscience 2024Quote: ... and 1 μl of AAV1 particles with pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (at titer ≥ 1 × 1010 vg/ml) (both from Addgene). Neurons had significant ChR2 and jRGECO1a expression by day in vitro (DIV ...
-
bioRxiv - Neuroscience 2024Quote: ... donor construct:each of the site-specific TALENs (TALEN L [Addgene #59025] and TALEN R [Addgene #59026]). The cell suspension with DNA was transferred to R-50×8 Multi-well Processing Assembly electroporation cuvettes ...
-
bioRxiv - Neuroscience 2024Quote: ... donor construct:each of the site-specific TALENs (TALEN L [Addgene #59025] and TALEN R [Addgene #59026]). The cell suspension with DNA was transferred to R-50×8 Multi-well Processing Assembly electroporation cuvettes ...
-
bioRxiv - Neuroscience 2022Quote: ... AAVS1-TALEN-L and AAVS1-TALEN-R were gifts from Danwei Huangfu (Addgene plasmid # 59025 and 59026) (González et al. ...
-
bioRxiv - Neuroscience 2023Quote: 1-4 evenly spaced ∼60 nl injections of the AAV1-synapsin-l-GCamp6f (Addgene, MA stock #100837) that had been diluted to a titer of ∼1×10^12 vg/mL using sterile PBS were made in each cranial window ...
-
bioRxiv - Cell Biology 2020Quote: ... of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572; http://n2t.net/addgene:26572; RRID:Addgene_26572). The mApple-myosin X was subcloned by the Protein Cloning and Expression Core facility of the MBI.
-
bioRxiv - Neuroscience 2021Quote: ... 52.11 mg, Addgene 59924; P, 30.15 mg, Addgene 59925; L, 23.70 mg, Addgene 59922; G, 20.26 mg, Addgene 59921). Cells were maintained with DMEM with GlutaMAX supplement ...
-
bioRxiv - Systems Biology 2022Quote: ... cassette from pKD4 (pKD4 was a gift from Barry L. Wanner (Addgene plasmid # 45605; http://n2t.net/addgene:45605; RRID:Addgene_45605), (Datsenko & Wanner ...
-
bioRxiv - Systems Biology 2022Quote: ... cassette from pKD3 (pKD3 was a gift from Barry L. Wanner (Addgene plasmid # 45604; http://n2t.net/addgene:45604; RRID:Addgene_45604)) ...
-
bioRxiv - Neuroscience 2021Quote: ... mice were microinjected 0.3 µl of AAV5-hsyn-NE2.1 (h-N01, WZ Biosciences) and 0.5 µl of AAV9-hsyn-jRGECO1a (100854, Addgene) to the left Cg1 (AP=2.2mm ...
-
bioRxiv - Developmental Biology 2021Quote: The Tg(fli1a:Brainbow1.0L)mu254 (flibow) transgenic fish was generated by cloning the CMV-Brainbow-1.0 L construct (Addgene #18721) downstream of the fli1a promoter62 ...
-
bioRxiv - Bioengineering 2024Quote: The Bclx(L) and Aven genes were cloned into a bi-cistronic pBUD-EFGP plasmid (Addgene Plasmid #23027). The Bclx(L ...
-
bioRxiv - Biochemistry 2024Quote: ... The sequence encoding NiV L was cloned into the 438-C vector (kind gift from Scott Gradia; Addgene plasmid # 55220 ...
-
bioRxiv - Cell Biology 2020Quote: ... The plasmid containing the α1C subunit (CaV1.2) of L-type Ca2+ channels was a gift from Diane Lipscombe (Addgene plasmid # 26572 ...
-
bioRxiv - Immunology 2022Quote: ... To subclone the fusion protein constructs GFPNKG2D-S/L into the retroviral stem cell vector pMIGR1 (Addgene, plasmid 27490), forward 5’ TAGTAGGAATTCGCCACCATGAGCGGGGGCGAGGAC 3’ and the reverse 5’ TAGAGGTCGACCTTACACCGCCCTTTTCATGCAG3’ primers were used ...
-
bioRxiv - Molecular Biology 2021Quote: ... (i) 0.5 μg of AAVS1-TALEN-L and AAVS1-TALEN-R (gift from Dr. Danwei Huangfu, Addgene plasmid # 59025) as well as 2 μg of targeting plasmid were used for nucleofection of hPSC cells ...
-
bioRxiv - Cancer Biology 2020Quote: ... L-Myc or LacZ open reading frame (ORF) was cloned into pLEX_307 (a gift from David Root, Addgene #41392) using the Gateway® cloning methods according to manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2024Quote: Following plasmids were used for transfection pN1-CMV-sDarken (Addgene plasmid #184799, pN1-CMV-L-sDarken (Addgene plasmid #184800), null-mutant of sDarken (created in house) ...
-
bioRxiv - Cell Biology 2020Quote: ... and 75 ng/µl of a construct expressing a sgRNA targeting ACGGCTCATAAGAGACTTGG (derived from p46169, which was a gift from John Calarco, Addgene plasmid # 46169 ...
-
bioRxiv - Neuroscience 2022Quote: ... Rats received bilateral intra-accumbens infusions (1 μl/side) of a Cre-dependent adeno-associated viral vector (AAV) expressing eYFP (AAV5-EF1a-DIO-eYFP-WPRE-hGH; Addgene) or a Cre-dependent AAV expressing ChR2 with an eYFP tag (AAV5-EF1a-DIO-hChR2(H134R)-eYFP-WPRE-hGH ...