Labshake search
Citations for Addgene :
1 - 50 of 105 citations for Estradiol 17 Beta Dehydrogenase 11 HSD17B11 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... Beta (Addgene # 170449), Gamma (Addgene # 170450) ...
-
bioRxiv - Biochemistry 2020Quote: ... DGK beta (Addgene; 35405) were from Robert Lefkowitz and Stephen Prescott ...
-
bioRxiv - Cell Biology 2020Quote: ... specifically: pETM-11 (AddGene) for Sar1 and pFASTBacHTb (AddGene ...
-
bioRxiv - Microbiology 2022Quote: ... IFN-Beta-pGL3 (Addgene 102597), or empty vector pcDNA3.1 (Life Technologies V79020 ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017 ...
-
bioRxiv - Cell Biology 2022Quote: ... and mCherry-Beta-Catenin-20 (Addgene plasmid 55001 ...
-
bioRxiv - Synthetic Biology 2023Quote: The promoters from the genes alcohol dehydrogenase 2 (ADH2, Addgene ID 195015), xylose reductase (XYL1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... YFP NLS Beta-Actin S14C and YFP NLS Beta-Actin G13R were a gift from Primal de Lanerolle (Addgene plasmid # 60613 ...
-
bioRxiv - Cell Biology 2021Quote: ... and pSFFV_mNG2(11)1-10 (Addgene #82610), respectively ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used pLV-beta-catenin ΔN90 (Addgene, #36985) and pPRIME-CMV-NEO-recipient (CTRL ...
-
bioRxiv - Cancer Biology 2021Quote: ... we used pXL002-ishRNA-beta-catenin-1 (Addgene, #36297) and pXL004-ishRNA-scramble (Addgene ...
-
bioRxiv - Microbiology 2019Quote: ... Transfection with GFP beta-actin (addgene #27123, Addgene, USA)(13 ...
-
bioRxiv - Developmental Biology 2021Quote: ... The plasmid E[beta]C (Addgene cat. no. 24312) was used ...
-
bioRxiv - Biophysics 2021Quote: ... and 11 μg packaging plasmid (psPAX2; Addgene #12260) using PEI at 2.5:1 (w/w ...
-
bioRxiv - Microbiology 2022Quote: ... and 11 μg of pMDLg/pRRE (Addgene # 12251) were co-transfected per tissue culture dish using Lipofectamine LTX reagent with PLUS reagent (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... coli strains containing pAC-BETA-At (Addgene plasmid no. #53288), pAC-ZETA (Addgene plasmid no ...
-
bioRxiv - Cell Biology 2023Quote: ... Homology arms were cloned into pDD268 [11] (Addgene #132523) using NEBuilder Hifi DNA assembly Master Mix (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 17 μg of plentiCas9-Blast (Addgene, Watertown, MA; #52962) by the calcium phosphate method ...
-
bioRxiv - Developmental Biology 2022Quote: The LARRY lentiviral barcoding library 17 was purchased from Addgene (https://www.addgene.org/pooled-library/camargo-plarry-egfp-barcoding-v1/) ...
-
bioRxiv - Cell Biology 2019Quote: ... EGFP-EPLIN beta - a gift from Elizabeth Luna (Addgene plasmid # 40948) - and pcDNA3-myc-FLNa WT - a gift from John Blenis (Addgene plasmid # 8982)(Woo et al. ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... ElonginC (17–112) and ElonginB (1–104) (Addgene ID 204500 & 204501) were co-expressed in E ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-adrenergic receptor-CFP was a gift from Catherine Berlot (Addgene plasmid # 55794 ...
-
bioRxiv - Molecular Biology 2022Quote: ... mCherry-Beta-Catenin-20 (a gift from Michael Davidson; Addgene plasmid # 55001), and pcDNA3-S33Y Beta-catenin (a gift from Eric Fearon (Kolligs et al ...
-
bioRxiv - Cell Biology 2020Quote: ... mApple-SSTR3-N-17 was a gift from Michael Davidson (Addgene # 54949). SSTR3 was shuttled into CSII-EF lentiviral vector into XhoI/XbaI site by Gibson cloning using the primers aacacgctaccggtctcgagaattcatggccactgttacctatcctt and tgctcaccatcagatggctcagtgtgctgg for SSTR3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... plasmids as described previously.11 pLKO.1-Scrambled plasmids (Addgene, #136035) were used as negative control ...
-
bioRxiv - Biochemistry 2022Quote: ... and mEmerald-Beta-Catenin-20 (Addgene plasmid # 54017; http://n2t.net/addgene:54017; RRID:Addgene_54017) were gifts from Michael Davidson.
-
bioRxiv - Biochemistry 2022Quote: ER-mCherry (mCh-Sec61 beta) plasmid was a gift from Gia Voeltz (Addgene 49155) (37) ...
-
bioRxiv - Microbiology 2020Quote: ... pMch-sec61-beta shows ER and the ER-Golgi intermediate compartment (Addgene cat 49155) (40) ...
-
bioRxiv - Genomics 2021Quote: ... The plasmid pCI-neo beta catenin S33Y was a gift from Bert Vogelstein (Addgene plasmid # 16519 ...
-
bioRxiv - Immunology 2021Quote: ... MSCV-beta-catenin-IRES-GFP was a gift from Tannishtha Reya (Addgene plasmid #14717). MSCV-Cre-IRES-GFP was previously described [9] ...
-
bioRxiv - Microbiology 2024Quote: ... 20ng encoding firefly luciferase driven by an IFN-beta promoter (IFN-Beta_pGL3, Addgene 102597), 5ng of renilla luciferase (pRL-TK - Promega E2241) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Each well was transfected with the PB-UniSAM plasmid (Addgene 99866 {Fidanza, 2017 #17}) containing either one of the four gRNAs against RUNX1C promoter {Fidanza ...
-
bioRxiv - Cell Biology 2022Quote: ... GCaMP6s-GTU construct was made based on mCherry-γ-Tubulin-17 backbone (Addgene #55050). GCaMP6s constructs were stably expressed in C2C12 cells to perform Ca2+ imaging ...
-
bioRxiv - Immunology 2021Quote: ... human embryonic kidney 293T/17 cells were transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786). Transfection was performed in 293T/17 cells using the genejuice (Novagen ...
-
bioRxiv - Developmental Biology 2020Quote: ... The expression vector pCAG-mNG2(11) were derived from pCAG-ERT2CreERT2 (Addgene #13777) (Matsuda and Cepko ...
-
bioRxiv - Cell Biology 2020Quote: ... the GFP11x7 cassette was PCR amplified from pACUH:GFP11×7-mCherry-beta-tubulin (Addgene, plasmid # 70218), and integrated at the 5’ end of the SHE1 open reading frame using the sequential URA3 selection/5-FOA counterselection method ...
-
bioRxiv - Cell Biology 2023Quote: ... mCherry-SEC61β was PCR amplified from mCh-Sec61 beta (a gift from Gia Voeltz (Addgene plasmid ...
-
bioRxiv - Cancer Biology 2023Quote: ... The ITGB3 sequence (pcDNA3.1-beta-3 was a gift from Timothy Springer; Addgene plasmid # 27289) was subcloned into pLenti6.3/TO/V5-Blasti (A11144 ...
-
bioRxiv - Cell Biology 2021Quote: ... Reduced Expression GFP beta actin was a gift from Rick Horwitz & Tim Mitchison (Addgene plasmid # 31502). In this plasmid the base pairs 91-544 of the enhancer region in the CMV promoter are deleted ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14754). Plasmids were purified from a host E ...
-
bioRxiv - Microbiology 2020Quote: ... GSK3β-WT (HA GSK3 beta wt pcDNA3 was a gift from Jim Woodgett, Addgene plasmid # 14753), GSK3β-S9A (HA GSK3 beta S9A pcDNA3 was a gift from Jim Woodgett ...
-
bioRxiv - Microbiology 2019Quote: ... the pSLC recombineering series (11) which was a gift from Swaine Chen (Addgene plasmid # 73194), pON.mCherry (21 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pSFFV_mNG2(11)1-10 plasmid was a gift from Bo Huang (Addgene plasmid # 82610) (Feng et al. ...
-
bioRxiv - Neuroscience 2022Quote: ... 250μl per site at an 11-degree angle) with AAV5-EF1α-DIO-ChR2-eYFP (Addgene) to selectively target neuronal populations expressing Cre ...
-
bioRxiv - Microbiology 2019Quote: ... ADRB1 was amplified from pcDNA3 Flag beta-1-adrenergic-receptor (gift from Robert Lefkowitz; Addgene plasmid # 14698). All fragments contained ~20bp overhangs and were assembled into EcoRV cut pLenti CMV Puro DEST (w118-1 ...
-
bioRxiv - Cell Biology 2021Quote: ... pcDNA3-HA-14-3-3 beta (14-3-3β) was a gift from Michael Yaffe (Addgene #13270). pclbw-opa1(isoform 1)-myc (myc-Opa1 ...
-
bioRxiv - Microbiology 2022Quote: ... pCMV encoding HIV-1 Vpr fused to beta lactamase (pCMV4-BlaM-Vpr) was obtained from Addgene (21950). A plasmid encoding replication-incompetent HIV-1 lacking env and vpr and encoding luciferase (pNL4-3LucR-E- ...
-
bioRxiv - Genetics 2022Quote: ... Guides were cloned into SpCas9-2A-GFP (pX458)17 plasmid (Addgene #48138, a gift of Feng Zhang). CRISPR guides used in this study are presented in Table S1 ...
-
bioRxiv - Molecular Biology 2022Quote: The sgRNAs of chromosome 15 and chromosome 17 were connected to the pX330-mCherry plasmid (Addgene, 98750). WT cells were transfected with 250□Jµl Opti-MEM that contained 5□Jµl Lipofectamine 2000 (Thermo Fisher ...
-
bioRxiv - Genomics 2019Quote: ... two different sequences targeting Denr were cloned into pLKO.1puro backbone vector (Addgene no. 10878 (11)) ...