Labshake search
Citations for Addgene :
51 - 100 of 435 citations for Ephrin B1 EFNB1 Mouse HEK293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... the pET-28b-RfxCas13d-His vector (Addgene, Plasmid #141322) was used for RfxCas13d protein production (Bon Opus Biosciences ...
-
bioRxiv - Biochemistry 2020Quote: ... The FLAG-His sequence in payload plasmid pKM491 (Addgene) was replaced with sequence for a 3×FLAG tag by Gibson Assembly (New England Biolabs ...
-
bioRxiv - Biochemistry 2020Quote: ... insoluble His-tag purification (Addgene ID: 139126, 139127, 139128)
-
bioRxiv - Biochemistry 2020Quote: ... soluble His-tag purification (Addgene ID: 139114, 139115 respectively)
-
bioRxiv - Cell Biology 2023Quote: ... pET-His-GST-tev-LIC (Addgene #29655, Gradia Lab), pGEX-4T-3-mR7BD (Addgene #79149 ...
-
bioRxiv - Cell Biology 2019Quote: ... The donor plasmid to insert mEGFP into the N-terminus of lamin B1 was purchased from Addgene (Cat# 87422). TrueCut Cas9 protein v2 and TrueGuide 1-piece modified synthetic gRNA (GGGGTCGCAGTCGCCATGGC ...
-
bioRxiv - Immunology 2021Quote: ... HEK293 and HEK/TLR4 cells were transiently transfected with pcDNA3.1(-)hACE2 (Addgene plasmid #1786) to generate HEK/ACE2 or HEK/TLR4/ACE2 cell lines ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg pBOB-EF1-FastFUCCI-Puro (86849 from Addgene, RRID:Addgene_86849) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg pBOB-EF1-FastFUCCI-Puro (86849 from Addgene, RRID:Addgene_86849) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Genomics 2019Quote: HEK293 cells were co-transfected with 400ng of pY117 (pcDNA3.1-huMb3Cpf1) (Cat. 92293, Addgene) and 100ng of crRNA PCR product using Lipofectamine 2000 (Cat ...
-
bioRxiv - Cell Biology 2023Quote: ... HEK293 cells were transfected with pFlagCMV2-14-3-3sigma (Addgene, Cambridge, MA, Plasmid #12453) (68) ...
-
bioRxiv - Cell Biology 2023Quote: CRISPR mediated knock-outs were performed by transducing HEK293 cells with LentiCRISPRV2 (Addgene #52961) lentivirus expressing sgRNAs targeting genes of interest (FASTKD5_sg1 ...
-
bioRxiv - Biophysics 2023Quote: ... 3C protease site cloned into a pcDNA3 vector containing human IgG Fc derived from pcDNA3-Nrxn1beta AS4(-)-Fc (a gift from Peter Scheiffele & Tito Serafini, Addgene plasmid # 59313 ...
-
bioRxiv - Cell Biology 2021Quote: pTRIP-SFFV-EGFP-NLS and the coding sequences of mEmerald-Lamin A/C and mEmerald-Lamin B1 were from Addgene. pLVX-N-GFP was a kind gift from Prof ...
-
bioRxiv - Cell Biology 2023Quote: ... cDNAs encoding either APC/C resistant (APC/CR) mVenus-cyclin A2 or mVenus-cyclin B1 were cloned into pINDUCER20 (plasmid #44012; Addgene) by replacing the gateway cassette sequence and were synthesized by Twist Biosciences ...
-
Structure-guided glyco-engineering of ACE2 for improved potency as soluble SARS-CoV-2 decoy receptorbioRxiv - Biochemistry 2021Quote: ... United States).62,63 Plasmid constructs pcDNA3-sACE2(WT)-Fc(IgG1) and pcDNA3-sACE2-T92Q-Fc(IgG1) were obtained from Addgene (United States). The N322Q mutation was introduced into ACE2-wt-Fc and ACE2-T92Q-Fc using the QuikChange Lightning Site-Directed-Mutagenesis kit (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... by flow cytometry on HEK293-FT cells transiently expressing SARS-CoV-2 N (Addgene # 141391), S (BEI # NR-52310 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Genetics 2019Quote: Plasmid pF2-bio-His was obtained from Addgene (plasmid #52179) and human F2 cDNA was amplified using primers containing vector sequence homology (Table S1) ...
-
bioRxiv - Cell Biology 2019Quote: His-tagged ubiquitin construct was obtained from Addgene (plasmid: #18712). siRNA#1 resistant RNF168-mCherry plasmid and RNF168 siRNAs were gift from Jiri Lucas (1) ...
-
bioRxiv - Biochemistry 2021Quote: ... SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163) and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164 ...
-
bioRxiv - Biochemistry 2021Quote: Plasmids SARS-CoV-2 nsp10-His-3xFlag (Addgene ID 169162), SARS-CoV-2 3xFlag-His-nsp5CS-nsp14 (Addgene ID 169163 ...
-
bioRxiv - Biochemistry 2020Quote: ... and cloned into a His-SUMO backbone (Addgene Plasmid #37507) for expression ...
-
bioRxiv - Biochemistry 2022Quote: ... The acp ORF was amplified from pET29a-acp-His (Addgene) using primers listed in Table S5 and inserted into SacI- and BamH1-digested pET28b-Smt3-His10 to give pET28b-Smt3-His10-acp.
-
bioRxiv - Molecular Biology 2020Quote: ... pET-His-hRan-Q69L was acquired from AddGene (catalog #42048) and pGEX-TEV-hCRM1 (XPO1 ...
-
bioRxiv - Genomics 2023Quote: ... were transformed with pET-28b-Cas9-His (Addgene, no. 47327) by heat shock following the manufacturers’ instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... were transformed with the plasmid pET28b-RfxCas13d-His (Addgene 141322), which contain the recombinant CasRx gene ...
-
bioRxiv - Genetics 2023Quote: His-SIRT5 expression plasmid was obtained from Addgene (plasmid #25487). Site-directed mutagenesis of WT SIRT5 was performed using the QuickChange Lightning site-directed mutagenesis kit (#210518 ...
-
bioRxiv - Developmental Biology 2020Quote: ... HEK293/HEK293T cells stably transduced with the Wnt reporter Super TOP-Flash (STF, Addgene Plasmid #12456) were previously described (Bauer et al ...
-
bioRxiv - Immunology 2023Quote: HEK293 cells expressing human ACE2 (previously described20) were transduced with lentiviruses carrying dCAS9-10xGCN4 (Addgene 60903) termed HEK293-ACE2-SunTag ...
-
bioRxiv - Biophysics 2020Quote: ... containing N-terminal 6-His-WT-p53 (1-303) (Addgene, 24859), was used to express p53 ...
-
bioRxiv - Developmental Biology 2021Quote: ... SpCas9 was expressed from pET28a-Cas9-His (Addgene plasmid number 98158) and purified in our lab ...
-
bioRxiv - Biochemistry 2021Quote: ... and SARS-CoV-2 nsp14/nsp10-His-3xFlag (Addgene ID 169164) were expressed in baculovirus-infected Sf9 insect cells ...
-
bioRxiv - Plant Biology 2024Quote: ... cells harboring the plasmid p2CT-His-MBP-Lbu_C2c2_WT (Addgene No. 83482) were cultivated with 800 ml autoinduction medium (Studier ...
-
bioRxiv - Cell Biology 2022Quote: ... new lentiviral particles were produced by transfecting HEK293 cells with 4µg Apple-53BP1trunc (69531 from Addgene, RRID:Addgene_69531) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... new lentiviral particles were produced by transfecting HEK293 cells with 4µg Apple-53BP1trunc (69531 from Addgene, RRID:Addgene_69531) + 4µg pMD2.G (12259 from Addgene ...
-
bioRxiv - Cell Biology 2020Quote: ... pLKO plasmids were co-transfected into HEK293-T cells along with packaging plasmids pMDLg/pRRE (Addgene #12251), pRSV-Rev (Addgene #12253 ...
-
bioRxiv - Microbiology 2019Quote: ... GM-CSF and IL-4 were produced from HEK293 cells transduced with pAIP-hGMCSF-co (Addgene #74168) or pAIP-hIL4-co (Addgene #74169) ...
-
bioRxiv - Microbiology 2019Quote: ... These cytokine-conditioned media were produced from HEK293 cells stably transduced with pAIP-hGMCSFco (Addgene no. 74168) or pAIP-hIL4-co (Addgene no ...
-
bioRxiv - Cell Biology 2022Quote: ... we co-transfected HEK293-FT cells with plasmids of interest with VSVG (pMD2.G; Addgene plasmid 12259) and psPAX2 (Addgene plasmid 12260 ...
-
bioRxiv - Biochemistry 2019Quote: ... pMAL-his-LbCpf1-EC was a gift from Jin-Soo Kim (Addgene plasmid # 79008 ...
-
bioRxiv - Biochemistry 2021Quote: The plasmid SARS-CoV-2 3xFlag-His-nsp5CS-nsp15 (Addgene ID: 169166) was used to express 3xFlag-His-nsp5CS-nsp15 in baculovirus-infected insect cells (Supplementary Table S1 and S2) ...
-
bioRxiv - Immunology 2022Quote: ... pVitro-hygro-N-myc-hVps34/Vps15-C-V5-his-plasmid (Addgene #24055), pEGFP-Atg14L (Addgene #21635 ...
-
bioRxiv - Biochemistry 2022Quote: pQE-60 roGFP2-His was a gift from Tobias Dick (Addgene #65046)(50) ...
-
bioRxiv - Cell Biology 2024Quote: ... Plasmid for expression of EPS15-GFP-His was obtained from Addgene (#170860). EPS15D177S was generated using QuickChange Lightning Site-Directed Mutagenesis Kit (Agilent ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were transfected with 4µg shRNA p53-puromycin (Fachinetti Lab) + 4µg pMD2.G (12259 from Addgene, RRID:Addgene_12259) + 4µg psPAX2 (12260 from Addgene ...
-
bioRxiv - Neuroscience 2022Quote: ... HEK293 cells grown in twelve 10 cm dishes were co-transfected with active myc-mTOR E2914K mutant (Addgene) and HA-Raptor (Kim et al. ...
-
bioRxiv - Cell Biology 2021Quote: Measurement of NFAT4 nuclear translocation in HEK293 cells was achieved by transient overexpression of NFAT4-GFP (Addgene #21664) as previously described(30 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Lentivirus was generated by co-transfection of HEK293 cells with viral vector and packaging plasmids psPAX2 (Addgene 12260) and pMD2.G (Addgene 12259 ...
-
bioRxiv - Bioengineering 2020Quote: ... and pcDNA3-SARS-CoV-2-S-RBD-Fc (Addgene Plasmid #141183) were obtained as gifts from Erik Procko ...