Labshake search
Citations for Addgene :
1 - 50 of 1533 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Most of the genes related with 14-3-3 were acquired from Addgene and cloned into pMX plasmids ...
-
bioRxiv - Genetics 2024Quote: ... pMXs.hSox2 (SRY-Box Transcription Factor 2, RRID:Addgene_17218), pMXs.hKlf4 (Kruppel Like Factor 4RRID:Addgene_17219) ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... The LexA_ER_B112 transcription factor was amplified from Addgene_58437 (FRP880_PACT1(−1-520)-LexA-ER-haB112-TCYC1 was a gift from Joerg Stelling ...
-
bioRxiv - Developmental Biology 2022Quote: The three conditional lines for transcription factor overexpression (Rosa-A, GA, GAP) were constructed by modifying the Ai3 targeting construct (Addgene #22797; (Madisen, et al., 2010). The EGFP insert in Ai3 was removed by FseI digestion and replaced with coding regions for the following ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L ...
-
bioRxiv - Biochemistry 2020Quote: pHA#843: hrp-1p∷hrp-1HsLCΔLC∷hrp-1 3’UTR (Addgene ID: 139200)
-
bioRxiv - Biochemistry 2020Quote: pHA#841: hrp-1p∷hrp-1HsLCWT∷hrp-1 3’UTR (Addgene ID: 139198)
-
bioRxiv - Biochemistry 2020Quote: pHA#842: hrp-1p∷hrp-1HsLCD290V∷hrp-1 3’UTR (Addgene ID: 139199)
-
bioRxiv - Neuroscience 2024Quote: The transcription factors and the reverse tetracycline transactivator (rtTA) were obtained from Addgene (Tet-O-Fuw-Ascl1 Addgene plasmid #27150 ...
-
bioRxiv - Cell Biology 2020Quote: ... following the CRISPR library-related instructions (#75316, Addgene). All PCRs were pooled and sequenced by Illumina sequencing (Duke Center for Genomic and Computational Biology (GCB) ...
-
bioRxiv - Biochemistry 2020Quote: pHA#849: mec-4p∷hrp-1HsLCD290VmScarlet∷hrp-1 3’UTR (Addgene ID: 139203)
-
bioRxiv - Biochemistry 2020Quote: pHA#848: mec-4p∷hrp-1HsLCWTmScarlet∷hrp-1 3’UTR (Addgene ID: 139202)
-
bioRxiv - Biochemistry 2020Quote: pHA#847: mec-4p∷hrp-1mScarlet∷hrp-1 3’UTR (Addgene ID: 139201)
-
bioRxiv - Genomics 2020Quote: pNTI729 was constructed by first amplifying the ZEM transcription factor from pNTI638 (pHES795 Addgene #87943) (17 ...
-
bioRxiv - Neuroscience 2021Quote: ... and the Egr1 transcription factor (pcDNA3-Egr1, a gift from Eileen Adamson, Addgene plasmid #11729) known to stimulate the Cav3.2 promotor 25.
-
bioRxiv - Genetics 2021Quote: ... to foster T7 in vitro transcription) for transcription from DR274 (DR274 was a gift from Keith Joung, Addgene plasmid #42250; Hwang et al., 2013).
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M) ...
-
bioRxiv - Developmental Biology 2024Quote: ... All FAK and related phosphoresistant variants were obtain from Addgene (YFP- FAK ...
-
Upregulated GIRK2 counteracts ethanol-induced changes in excitability & respiration in human neuronsbioRxiv - Neuroscience 2024Quote: ... NPCs were induced into neurons with doxycycline-inducible transcription factor NGN2 with neomycin antibiotic selection (Addgene #99378), following the protocol described by (Ho et al. ...
-
bioRxiv - Neuroscience 2024Quote: ... gRNAs for deleting the target regions or transcription factors were designed and cloned into the pb_rtTA_Bsmb1 plasmid (Addgene) using Golden Gate Assembly (NEB) ...
-
bioRxiv - Neuroscience 2024Quote: ... Plasmids related to this study and their sequences are available from Addgene. AAV viral preps associated with some of the plasmids are available from Addgene (https://www.addgene.org/Gordon_Fishell/ ...
-
bioRxiv - Cell Biology 2022Quote: ... gRNA (5’ - TTACTGCTCATCCTTGTCCT-3’) was cloned into pCFD5 vector (Port et al., 2014) (Addgene #73914) and then the resulting vector was injected into attP2 site (BDSC #25710) ...
-
bioRxiv - Cell Biology 2023Quote: ... and (3) GFP1-10 from pFA6a-link-yGFP1-10-CaURA3MX (Addgene 86419; (Smoyer et al., 2016)) and subsequent cloning into the XhoI/NotI sites of pRS304 mito-DsRed.
-
bioRxiv - Biochemistry 2020Quote: ... To generate mec-4p∷hrp-1 mScarlet plasmids, mScarlet (Bindels et al., 2017) was amplified from pmScarlet_C1 (Addgene 85042) and assembled into hrp-1HsLCWT using NEBuilder HiFi DNA Assembly kit and introducing the D290V mutation by Quickchange ...
-
bioRxiv - Molecular Biology 2024Quote: ... reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate enhancer reporter donor constructs into the AAVS1 locus by electroporation of 1 × 106 K562 cells (or K562 cells selected to have the desired synthetic transcription factor) with 1 ng of reporter donor plasmid and 0.5 ng of each TALEN-L (Addgene no. 35431) and TALEN-R (Addgene no ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 D28N were generated by electroporation of pCMV_BE4max (Addgene #112093; Koblan et al., 2018) and phU6-gRNA expression cassette encoding the guide sequence AAGCGTCAGTCTGCCCTCCA (Addgene #53188 ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Genes encoding natural transcription factors were sourced from: cJun (pCLXSN-c-JUN, which was a gift from Jin Chen, Addgene plasmid #102758)36 and BATF (pFUW-TetO-BATF ...
-
bioRxiv - Cancer Biology 2022Quote: ... sgRNA constructs for ANKLE1 knockout were generated by inserting oligonucleotides containing the targeted sequences (5′-TTCAGGGCACAGCCTAGAAC -3′ and 5′-GATTCT-GCCCTAGCCCCACC -3′) into the pX458 vector (Addgene Plasmid #48138 (Ran et al. 2013)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... At least two independent sets of oligonucleotide pairs for gene knockdown of human MTs and the transcription factor MTF-1 (supplementary table S4) were synthesized and cloned into the pLKO.1-TCR vector (Addgene, Cambridge, MA, USA); the same vector was also used as an empty vector control ...
-
bioRxiv - Cell Biology 2023Quote: ... fibroblasts were reprogrammed using lentiviral vectors that carried six transcription factors (ADDGENE/PSIN4-EF2-N2L, ADDGENE/PSIN4-EF2-O2S and ADDGENE/PSIN4-CMV-K2M). Fibroblast cells were plated in 6-well plates at 1.5 x 105 cells per well (Day 0) ...
-
bioRxiv - Biophysics 2020Quote: ... pCDNA-3xHA-Reptin or pCDNA-3xFLAG-Pontin (Izumi et al., 2010; Rajendra et al., 2014; Venteicher et al., 2008) (Addgene plasmids), pcIneoFLAG-UPF2 (generous gift from Andreas Kulozik ...
-
bioRxiv - Cell Biology 2021Quote: ... with that of mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Cell Biology 2021Quote: ... The cDNA encoding mEos3.2-paxillin was generated by replacing the cDNA encoding mGFP in the mGFP-paxillin plasmid with that encoding mEos3.2 (Zhang et al., 2012) (generated by making 3 point mutations, I102N, H158E, and Y189A in the Addgene mEos2 plasmid #20341 [http://n2t.net/addgene:20341 ...
-
bioRxiv - Neuroscience 2022Quote: Plasmids 61591 (Ran et al, 2015) and 106219 (Thakore et al, 2018) (Addgene) were modified for the gene editing (SaCas9 ...
-
bioRxiv - Cell Biology 2024Quote: ... eGFP-Rab6b (Rzomp et al., 2003(Rzomp et al., 2003; Addgene plasmid #49470), eGFP-Rab6b Q72L (Addgene plasmid #49889) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Both the pMR promoter used to drive SRP54* gene expression as well as the synMR transcription factors were gifts from Ahmad Khalil (Addgene #194491 and #194481 respectively). Site-directed mutagenesis was used to create all mutants used in this work via HiFi assembly using complementary primers and NEBuilder HiFi DNA assembly master mix (NEB Cat # E2621S ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Molecular Biology 2024Quote: To generate RAD54L2 knockouts a double-stranded DNA oligo encoding a sgRNA targeting the RAD54L2 5’ region from the TKOv3 library (Hart et al, 2017) (5’-AAGATGGGCAGCAGCCGCCG CGG–3’) was cloned into pSpCas9(BB)-2A-Puro (PX459) (RRID: Addgene_48139) to yield PX459-RAD54L2.
-
bioRxiv - Biochemistry 2023Quote: ... IGF2BP3: 5’-ACGCGTAGCCAGTCTTCACC-3’) were cloned into the pSpCas9 (BB)-2A-GFP (PX458) (plasmid #48138; Addgene, (Ran et al. 2013)) ...
-
bioRxiv - Bioengineering 2021Quote: Cloning of dLight1.3b and related mutant constructs was performed on the background of a pCMV_dLight1.1 (Addgene #111053) expression vector plasmid ...
-
bioRxiv - Genetics 2024Quote: ... pMXs.hKlf4 (Kruppel Like Factor 4RRID:Addgene_17219), pMXs.hc-Myc (MYC Proto-Oncogene ...
-
bioRxiv - Cancer Biology 2022Quote: ... the shRNA sequences (5′-CTCATTTAGCAGACATCGCAA-3′ (shRNA-1) and 5′-CTTTACTAGGAGACGCCAATA-3′ (shRNA-2) (Zhang et al, 2012b)) were inserted into EZ-Tet-pLKO-Puro vector (Addgene, 85966), respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... the miniIAA7 sequence was amplified using primers miniIAA-5-XbaI and miniIAA-3-XbaI as well as pSH-EFIRES-B-Serpin-miniIAA7-mEGFP plasmid DNA (Li, Prasanna et al. 2019) (ADDGENE: #129719) as a template ...
-
bioRxiv - Cell Biology 2024Quote: ... The complete ORF of AtAFB2 was amplified using primers AtAFB2-5-XbaI and AtAFB2-3-HindIII as well as pSH-EFIRES-P-AtAFB2 plasmid DNA (Li, Prasanna et al. 2019) (ADDGENE: #129715) as a template ...
-
bioRxiv - Genetics 2024Quote: ... targeting the 5’ and 3’ ends of the ao gene into pCFD4 U6:1_U6:3tandemgRNAs (Port et al. 2014; Addgene plasmid #49411). The repair template sequence ...
-
bioRxiv - Cell Biology 2024Quote: ... was either mutagenized in a 3 kb cloning plasmid (pKSPS (Bahri et al., 2021)) before subcloning into pQCXIB (the retroviral expression vector, Addgene plasmid #22800) or was directly mutagenized in pQCXIB ...
-
bioRxiv - Genomics 2022Quote: ... the genome-wide CRISPR-Cas9/KO Toronto Knockout version 3 library from Hart and team (Hart et al., 2017) (Addgene no. 90294), cloned into the 1 vector system (lentiCRISPRv2 carrying Cas9 and sgRNA expression on the same vector ...
-
bioRxiv - Synthetic Biology 2021Quote: ... a small ubiquitin-related modifier (SUMO) sequence known to increase soluble expression (61) derived from pDest-Sumo (Addgene #106980) (62) ...
-
bioRxiv - Microbiology 2020Quote: pBA439(Adamson et al., 2016) (Addgene #85967) was engineered to replace Cas9-gRNA cassette with Psp direct repeat (DR ...
-
bioRxiv - Biochemistry 2020Quote: ... Tsien (Palmer et al., 2006) (Addgene #36324). D1cpV-px (PST 2169 ...