Labshake search
Citations for Addgene :
1 - 50 of 913 citations for DNA Mismatch Repair Protein Msh3 MSH3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: The mismatch repair assay was performed as described previously57 using plasmids pGEM5Z (+)-EGFP (Addgene, cat #65206) and p189 (Addgene ...
-
bioRxiv - Physiology 2024Quote: ... Repair templates in pDD282 (Addgene 66823) (forward primer for upstream arm ...
-
bioRxiv - Cell Biology 2024Quote: The DSB repair reporter vectors pDRGFP (Addgene plasmid #26475 ...
-
bioRxiv - Cell Biology 2024Quote: ... and a plasmid having repair template (Addgene #97088) These plasmids were a gift from Archa Fox ...
-
bioRxiv - Developmental Biology 2020Quote: ... The repair template was assembled into pMLS257 (Addgene #73716) using SapTrap with custom and SEC modules as follows (from 5’ to 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: The mIAA7 repair templates were cloned into pBSK+ (Addgene #212207) using the Gibson assembly cloning strategy (Gibson et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... Homologous repair templates were cloned into pDD282 (Addgene plasmid #66823) or pDD284 (Addgene plasmid #66825 ...
-
bioRxiv - Cell Biology 2024Quote: ... A donor repair template (backbone C-terminal tagging: pHD-DsRed - Addgene #51434 ...
-
bioRxiv - Cell Biology 2023Quote: ... 10 pmol of PCR repair template amplified from pSNAP-tag plasmid (Addgene #101135) or mTagBFP2 plasmid (Addgene #75029 ...
-
bioRxiv - Genetics 2024Quote: ... which contains a Rosa26 targeting gRNA and the pTLR repair vector (Addgene Plasmid # 64322) into WT ...
-
bioRxiv - Cell Biology 2024Quote: The DSB repair reporter vectors pDRGFP (Addgene plasmid #26475; http://n2t.net/addgene:26475; RRID: Addgene_26475) and hprtSAGFP (Addgene plasmid #41594 ...
-
bioRxiv - Cell Biology 2024Quote: ... For N-terminal tagging a repair donor plasmid consisting of mCherry2 (derived from Addgene plasmid # 72831), flanked by a total of 6X Flag repeat epitope tags was generated ...
-
bioRxiv - Synthetic Biology 2020Quote: ... targeting the LMNB1 gene (GGGGTCGCAGTCGCCATGGC) (2 ug) and an LMNB1-mEGFP containing repair vector (Addgene plasmid #87422) (3 μg ...
-
bioRxiv - Developmental Biology 2021Quote: ... The GFP::AID::let-413 repair template was cloned using SapTrap assembly into vectors pDD379 (Addgene #91834) and pMLS257 ...
-
bioRxiv - Cell Biology 2024Quote: ... For C-terminal tagging a homology directed repair donor plasmid containing mClover3 (derived from Addgene plasmid 72829), followed by 24xMS2V5 33 was created ...
-
bioRxiv - Genomics 2023Quote: ... The CLYBL-specific homology directed repair construct pUCM-CLYBL-hNIL was a gift from Michael Ward (Addgene plasmid #105841 ...
-
bioRxiv - Developmental Biology 2023Quote: PCR amplification of the repair template was performed using 50 ng of plasmid containing mNeonGreen (Addgene 125134) as template in a touchdown PCR reaction (annealing temperature decreased 1°C from 65°C to 50°C for the first 15 cycles followed by 20 cycles with an annealing temperature of 50°C ...
-
bioRxiv - Immunology 2021Quote: ... The plasmid was then co-injected into the pronucleus with a repair template plasmid (i.e. targeting vector, Addgene) containing an IRES-DTR-tdTomato fusion cassette ...
-
ZNF143 binds DNA and stimulates transcription initiation to activate and repress direct target genesbioRxiv - Genomics 2024Quote: ... We generated a linear homology-directed repair donor by amplifying the pCRIS-PITChv2-dTAG-Puro plasmid (Addgene #91796) with the primers in Table 1 (Nabet et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... Co-transformations were made with 5μg of repair fragment and 1μg of plasmid expressing cas9 (Addgene 60847, Table S7) (Ryan et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... The Cas9-sgRNA gap repair vector pWS174 (which was a gift from Tom Ellis lab and Addgene plasmid # 90961) was linearized with BsmBI (NEB ...
-
bioRxiv - Developmental Biology 2023Quote: ... A repair plasmid was generated by cloning sequences flanking the intended insertion site (homology arms) into pDD282 (Addgene #66823) digested with AvrII and SpeI ...
-
bioRxiv - Cell Biology 2024Quote: ... A donor repair template (backbone C-terminal tagging: pHD-DsRed - Addgene #51434; backbone N-terminal tagging: pUC19-Addgene #50005) carrying the tag as well as a loxP-DsRed-loxP eye marker cassette flanked by 600-1000 bp homology regions up- and downstream of the start codons (for N-terminally tagged mCherry::Nup358 ...
-
bioRxiv - Bioengineering 2021Quote: ... were PCR amplified from PmCDA1-1x uracil-DNA glycosylase inhibitor protein (UGI) (Addgene #79620), evoCDA1 pBT277 (Addgene #122608) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The donor repair template was constructed on the pScarlessHD-DsRed plasmid (a gift from Kate O’Connor-Giles, Addgene plasmid # 64703), which contains a DsRed selection marker cassette flanked by PBac transposon ends and TTAA sites97 ...
-
bioRxiv - Developmental Biology 2021Quote: ... ACTB repair template AICSDP-15: ACTB-mEGFP was a gift from The Allen Institute for Cell Science (Addgene plasmid # 87425). SOX9 repair template was created by Infusion (638909 ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsDNA repair templates were amplified using primers with 5’ SP9 modifications (IDT) from the pJRK86 plasmid (AID*::GFP, Addgene #173743) and mIAA7 repair template plasmids in table 1 ...
-
bioRxiv - Systems Biology 2022Quote: ... pEF and minCMV promoter reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate donor constructs (pEF promoter: Addgene #161927 ...
-
bioRxiv - Systems Biology 2022Quote: ... K562 reporter cell lines were the same as those used in the original HT-recruit study8 and were generated by TALEN-mediated homology-directed repair to integrate donor constructs (JT039 with EF1a reporter: Addgene #161927 ...
-
bioRxiv - Synthetic Biology 2022Quote: ... pEF and minCMV promoter reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate donor constructs (pEF promoter: Addgene #161927 ...
-
bioRxiv - Cell Biology 2021Quote: ... The sgRNA (100 ng/μl) and SEC repair template (20 ng/μl) plasmids combined with Peft-3::Cas9 (60 ng/μl; Addgene #46168) and Pmyo-2::mCherry co-injection marker (2.5 ng/μl ...
-
bioRxiv - Systems Biology 2022Quote: ... pEF and minCMV promoter reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate donor constructs (pEF promoter: Addgene #161927, minCMV promoter: Addgene #161928) into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431 ...
-
bioRxiv - Cell Biology 2024Quote: ... and ligated into the pre-digested promoter-less plasmid to generate the pAAVS1-P-CAG-mNG21-10 repair template (Addgene #206042). For BclI digestion ...
-
bioRxiv - Synthetic Biology 2022Quote: ... pEF and minCMV promoter reporter cell lines were generated by TALEN-mediated homology-directed repair to integrate donor constructs (pEF promoter: Addgene #161927, minCMV promoter: Addgene #161928) into the AAVS1 locus by electroporation of K562 cells with 1000 ng of reporter donor plasmid and 500 ng of each TALEN-L (Addgene #35431 ...
-
bioRxiv - Systems Biology 2022Quote: ... K562 reporter cell lines were the same as those used in the original HT-recruit study8 and were generated by TALEN-mediated homology-directed repair to integrate donor constructs (JT039 with EF1a reporter: Addgene #161927; DY032 with minCMV reporter: Addgene #161928) into the AAVS1 locus using hAAVS1 1L TALEN (Addgene #35431 ...
-
bioRxiv - Cancer Biology 2023Quote: ... two sgRNA sequences for KRAS as well as an sgRNA sequence to linearize the repair template plasmid were inserted into the px458_Conc3 plasmid (Addgene Plasmid #134450) using Golden Gate Cloning ...
-
bioRxiv - Genetics 2023Quote: ... Cells were co-transfected with Cas9-gRNA RNP complex together with the repair oligo and Puromyin-GFP plasmid39 (Addgene, Watertown, MA) using Lipofectamine Stem transfection reagent (ThermoFisher ...
-
bioRxiv - Immunology 2023Quote: ... The homology directed repair (HDR) template was generated by PCR from a template plasmid (a gift from Alexander Marson, Addgene plasmid #112021)(45 ...
-
bioRxiv - Genomics 2024Quote: ... the pEF reporter was inserted at the AAVS1 safe harbor locus by TALEN-mediated homology-directed repair to integrate the pEF reporter donor plasmid (pJT039, Addgene no. 161927). 1000 ng of pJT039 and 500 ng of each TALEN-L (Addgene no ...
-
bioRxiv - Biochemistry 2024Quote: ... HDR repair templates were produced by PCR with target-specific primers containing the homology arms and the plasmid pMaCTag-P05 (Addgene plasmid 120016)89 In addition to the homology arms and the eGFP sequence ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The SNAP protein was amplified from the DNA-CARzeta-GFP plasmid (a gift from Ron Vale, Addgene # 89344). The monomeric streptavidin (mSA) ...
-
The tetrapeptide sequence of IL-1β regulates its recruitment and activation by inflammatory caspasesbioRxiv - Immunology 2023Quote: ... DNA encoding the indicated proteins were inserted between the attR recombination sites and shuttled into modified pLEX_307 vectors (Addgene) using Gateway technology (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... The β-arrestin2 green fluorescent protein (GFP) plasmid DNA was originally created by Robert Lefkowitz and obtained from Addgene (plasmid #35411 ...
-
bioRxiv - Bioengineering 2020Quote: Libraries of linear DNA fragments encoding variants of the designed proteins were transformed together with linearized pCTcon2 vector (Addgene #41843) based on the protocol previously described by Chao and colleagues (68) ...
-
bioRxiv - Biochemistry 2022Quote: The pET28a plasmid vector containing DNA sequences encoding the PANK3 protein (residues pro12 to Asn368) was purchased from Addgene (25518) and transformed into both E ...
-
bioRxiv - Developmental Biology 2023Quote: ... we aimed to substitute the endogenous Cas9 cassette by targeting the Cas9 protein to the Cas9 DNA flanking regions either with a dCas9-VP64 donor sequence from Addgene plasmid 61425 or a dCas9-KRAB donor ...
-
bioRxiv - Synthetic Biology 2022Quote: ... cells were co-transfected using Lipofectamine 3000 and 15μg of DNA encoding for viral protein (pCMV14-3X-Flag-SARS-CoV-2 S was a gift from Zhaohui Qian - Addgene plasmid # 145780 ...
-
bioRxiv - Biochemistry 2023Quote: E.coli codon optimized gBlocks encoding CAHS D and its mutant proteins used in this study were synthesized by (Integrated DNA Technologies) and cloned into pET-28 b (+) vector (Addgene) for bacterial expression ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Samples were incubated with Protein A/G-MNase fusion protein (Addgene, Cat #123461) at 700 ng/mL for 1 hour at 4°C ...