Labshake search
Citations for Addgene :
1 - 50 of 625 citations for D Ribitol 5 Phosphate Cytidylyltransferase ISPD CRPPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2023Quote: ... working dilution 1:5) or d-Light1 (pAAV-CAG-dLight1.1, Addgene viral prep # 111067-AAV5 ...
-
bioRxiv - Biochemistry 2021Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, 12259) and pTAT (kind gift of P ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral expression constructs were packaged in HEK293FT cells using calcium phosphate transfection of psPAX2 and pMD2.G (kind gifts of D. Trono; Addgene #12260, #12259) and pTAT (kind gift of P ...
-
bioRxiv - Synthetic Biology 2023Quote: ... D-sup (Addgene #90019) and DMC1 (CRG ORFome collection ...
-
bioRxiv - Cancer Biology 2022Quote: ... Calcium phosphate transfection was used to generate EGFR-G719C (Addgene 116254), EGFR-L858R (Addgene 11012) ...
-
bioRxiv - Neuroscience 2024Quote: ... D) or AAV2/5-CAG-dLight1.1 (left hemisphere: one mouse, right hemisphere: four mice, 111067-AAV5, Addgene, Watertown, MA, USA, Fig. 1E, F) was injected into the dorsomedial striatum (DMS ...
-
bioRxiv - Genetics 2022Quote: ... pENTR/D-CreERT2 (Addgene#27231)(Mosimann et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... James D Sutherland (Addgene: #208041) in which the TURBO-ID region was substituted by a 3HA-tag and the murine form of Sox11 (obtained from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentivirus was generated in 293T cells by calcium phosphate cotransfection with psPAX2 (Addgene #12260), pCMV-VSV-g (Addgene #8454) ...
-
bioRxiv - Cancer Biology 2024Quote: Lentivirus was prepared by calcium phosphate transfection of 293T cells using psPAX (Addgene # 12260) and pMD2.G (Addgene # 12259) ...
-
bioRxiv - Genetics 2021Quote: ... HEK293T cells were transfected using calcium phosphate with psPAX2 (gift from Didier Trono, Addgene No.12260), pCAG-Eco (gift from Arthur Nienhuis and Patrick Salmon ...
-
bioRxiv - Cell Biology 2022Quote: ... and PJ-DEAD (PJ-D) (Addgene plasmid # 38002) were gifts from Robin Irvine ...
-
bioRxiv - Cancer Biology 2023Quote: ... and env-expressing plasmids (pMD2.G and psPAX) using the calcium-phosphate method.30 pMD2.G (Addgene plasmid #12259 ...
-
bioRxiv - Synthetic Biology 2023Quote: ... psPAX2 (Addgene plasmid #12260, a gift from D. Trono), and pCMV-VSV-G-RSV-Rev (RIKEN BioResource Research Center plasmid RDB04393 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV2/5: pAAV2/5 was a gift from Melina Fan (Addgene plasmid # 104964 ...
-
bioRxiv - Neuroscience 2024Quote: ... and then were used to lentivirus package based on calcium phosphate method along with plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Neuroscience 2021Quote: ... targeted to mouse PGRN exon 1 (oligos with 5’-cacc gGCTCCCTGGGAGGCATCTGG-3’ and 5’-aaac CCAGATGCCTCCCAGGGAGCc-3’ or 5’-cacc gCGGACCCCGACGCAGGTAGG-3’ and 5’-aaac CCTACCTGCGTCGGGGTCCGc-3’ were ligated to pLenti-CRISPRv2 (Addgene)) or Cas9 only ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tet-pLKO-puro (gift from D. Wiederschain, Addgene plasmid # 21915) was digested with AgeI and EcoRI and isolated by gel purification (QIAEX II Gel Extraction Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... vector eGFP-pWPT (Addgene #12255, kind gift from D. Trono) was used to express eGFP ...
-
bioRxiv - Cancer Biology 2023Quote: ... packaging with psPAX2 (gift of D. Trono; Addgene plasmid #12260) and pseudo typed with pMD2.G (gift of D ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µg psPAX2 (a gift from D. Trono, Addgene #12260), and 0.7 µg pMD2.G (a gift from D ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene #104964), pAAV2/6 (Addgene #110660) ...
-
bioRxiv - Molecular Biology 2023Quote: Constructs for shRNA targeting Primpol (5’- ATTTAGCCGACACCTAATATT) Smarcal1 (5’- CTGATTCAAGAGAAGATTAAA) and Smug1 (5’- AACTATGTGACTCGCTACT) were designed and inserted into pLKO.1neo plasmid (Addgene #13425). Lentiviruses were generated using a standard protocol (Feng and Jasin ...
-
bioRxiv - Microbiology 2020Quote: All virus-like particles were generated in HEK293T cells via calcium phosphate transfection using packaging plasmids psPAX2 (Addgene #12260) and pMD2.G (Addgene #12259) ...
-
bioRxiv - Bioengineering 2022Quote: ... Lentivirus was produced using calcium phosphate co-transfection of HEK293T cells with the psPAx2 plasmid (packaging vector, Addgene #12260), pMd2g plasmid (VSVG envelope ...
-
bioRxiv - Cancer Biology 2023Quote: ... and env-expressing plasmids (pMD2.G and psPAX) using the calcium-phosphate method.30 pMD2.G (Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259) and psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Neuroscience 2023Quote: ... The 5-HT1eR and 5-HT1FR PRESTO-Tango constructs were obtained from Addgene. For transfection ...
-
bioRxiv - Neuroscience 2024Quote: ... a vector eGFP-pWPT (Addgene #12255, kind gift from D. Trono) was used to express eGFP and a home-made vector containing LifeAct-RFP – IRES - EB3-YFP were used to express both LifeAct-RFP and EB3-YFP ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK 293T derived amphotrophic phoenix cells were transfected by calcium phosphate method with 25μM chloroquine and the corresponding shRNA-targeting MLP vector in combination with psPax2 (Addgene, #12260) and pMD2.G (Addgene #12259 ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transfected using calcium phosphate method with 4-6 µg plasmid DNA and 8 µg of each pMD2.G and psPAX2 (Addgene). After 48 h ...
-
bioRxiv - Cell Biology 2020Quote: ... 5′-CAAACAATCAGCAATGCCTG-3′ and 5′-TGAAGTATTCAGAACAGAAG-3′ and cloned into pX330-P2A-EGFP (Addgene) through ligation using T4 ligase (New England Biolabs) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 μg pVSV (#138479, Addgene), 8 μg psPAX2 (#12260 ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 μg p8.9NdeltaSB (Addgene #132929) and 0.5 μg pCMV-VSV-G (Addgene #8454) ...
-
bioRxiv - Neuroscience 2023Quote: ... pAAV2/5 (Addgene Plasmid #104964), and pHelper (Cell Biolab ...
-
bioRxiv - Cancer Biology 2023Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 µg pRSV-Rev (Addgene 12253 ...
-
bioRxiv - Immunology 2021Quote: ... Lentiviruses were produced into HEK293T cells by using the calcium phosphate co-transfection method for each specific subcloned lentiviral pLKO.3G vector with the packaging plasmids gag/pol (Addgene #14887) and VSV-G (Addgene #14888) ...
-
bioRxiv - Pathology 2021Quote: ... HEK293T cell (2.5 × 106) were seeded in a 100 mm-dish and co-transfected by calcium phosphate with 10 μg pLVTHM/GFP (Addgene 12247), 7.5 μg psPAX2 (Addgene 12260) ...
-
bioRxiv - Genomics 2024Quote: ... 4.5 x 106 cells were transfected using the calcium phosphate precipitation method (Salmon and Trono, 2007) with 6 μg pMD2.G (Addgene #12259), 15 μg psPAX2 (Addgene #12260 ...
-
bioRxiv - Cell Biology 2023Quote: Lentiviral particles were prepared in HEK293T cells using standard calcium-phosphate transfection of the lentivector with packaging plasmids pMD2.G (Trono lab, Addgene #12259) and pCMV-dR8.74 (Trono lab ...
-
bioRxiv - Developmental Biology 2023Quote: ... Virus was produced in HEK293T cells (ATCC CRL-3216) by calcium phosphate co-transfection of lentiviral shuttle and packaging vectors (pRRE (Addgene #12251), pRev (Addgene #12253) ...
-
bioRxiv - Neuroscience 2024Quote: HEK293FT cells were transfected by calcium phosphate with lentiviral constructs along with the associated packaging plasmids psPAX2 (a gift of Didier Trono, Addgene #12260) and pMD2.G (a gift of Didier Trono ...
-
bioRxiv - Neuroscience 2024Quote: HEK293FT cells were transfected using calcium phosphate transfection with lentiviral constructs and the associated packaging plasmids psPAX2 (a gift of Didier Trono, Addgene #12260) and pMD2.G (a gift of Didier Trono ...
-
Linear ubiquitination at damaged lysosomes induces local NF-κB activation and controls cell survivalbioRxiv - Cell Biology 2023Quote: ... GFP as non-human target (NHT) control (5’-GGAGCGCACCATCTTCTTCA-3’, 5’-GCCACAAGTTCAGCGTGTC-3’, and 5’-GGGCGAGGAGCTGTTCACCG-3’) cloned into pLentiCRISPRv2 (Addgene, 52961, deposited by Feng Zhang). To generate lentiviral particles ...
-
bioRxiv - Physiology 2021Quote: ... and/or mCherry-HSP90 (provided by D. Picard, Addgene plasmid #108223; RRID:Addgene_108223). Cells were cultured in Ham’s F12K media (ThermoFisher Scientific ...
-
bioRxiv - Physiology 2021Quote: ... and/or mCherry-HSP90 (provided by D. Picard, Addgene plasmid #108223; RRID:Addgene_108223). Cells were cultured in Ham’s F12K media (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: An HBV genotype D subtype ayw replicon (62) was obtained from Addgene. HBV Ae (genotype A) ...
-
bioRxiv - Neuroscience 2023Quote: ... 76 and CaVα2δ1 (p752; CaVα2δ1 was a gift from D. Lipscombe, Addgene plasmid # 26575 ...
-
bioRxiv - Cell Biology 2023Quote: ... and 0.7 µg pMD2.G (a gift from D. Trono, Addgene #12259), mixed with 9 µL lipofectamine 2000 transfection reagent in 2 mL Opti-MEM-I medium ...
-
bioRxiv - Microbiology 2023Quote: ... respectively and cloned into the pLenti6/V5-D-TOPO backbone (Addgene, #22945). The mouse Cul1 and Ube2l3 coding sequences were amplified from cDNA prepared from NiMOE cells and cloned into the pLenti6/V5-D-TOPO backbone (Addgene ...