Labshake search
Citations for Addgene :
1 - 50 of 915 citations for Cytosolic arginine sensor for mTORC1 subunit 2 CASTOR2 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: The cytosolic roGFP2 sensor was cloned from Addgene 49435 into a retroviral backbone pLPCX by Gibson Assembly ...
-
bioRxiv - Cell Biology 2023Quote: ... The cytosolic ATP sensor cyto-iATPSnFR1.0 was a gift from Baljit Khakh (Addgene plasmid# 102550 ...
-
bioRxiv - Cell Biology 2021Quote: ... and cytosolic Ca2+ was monitored by the intensity of the sensor R-GECO (plasmid was a gift from R. Campbell, Addgene #45494). To decrease cytosolic Ca2+ ...
-
bioRxiv - Cell Biology 2020Quote: ... Flag-tagged cytosolic APEX2 (Addgene, 49386) was then amplified by polymerase chain reaction (PCR ...
-
bioRxiv - Biophysics 2024Quote: The RhoA sensor construct was made by recombining commercial RhoA sensor plasmid from Addgene into the LZBob-neo-vector ...
-
bioRxiv - Cancer Biology 2022Quote: CMV pCalpain-sensor (Addgene #36182) composed of eCFP (donor ...
-
bioRxiv - Cell Biology 2020Quote: ... Genetically-encoded sensors for glutamate (Addgene) (GltI253-cpGFP.L1LV/L2NP ...
-
bioRxiv - Cell Biology 2024Quote: Peredox NADH/NAD+ sensor (Cat# 163060, Addgene) was transfected into HEK293 cells for lentivirus production ...
-
bioRxiv - Neuroscience 2020Quote: ... rat α2δ1 subunit (Addgene, accession number AF286488), and the zebrafish β4b subunit (accession number KC192785) ...
-
bioRxiv - Biochemistry 2023Quote: ... sapiens SUV39H2 catalytic subunit (Addgene plasmid #25115) Escherichia coli expression plasmids used in this study were acquired from Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... hTERT-RPE1 Plk1 FRET Sensor cells were prepared by transfecting Plk1-FRET sensor c-jun substrate plasmid37 (Addgene: 45203) in hTERT-RPE1 cells using X-tremeGENE™ 9 (Merck ...
-
bioRxiv - Cell Biology 2022Quote: ... MaLionR ATP sensor was obtained from Addgene (#113908) (Arai et al. ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 ng of the EPAC sensor (Addgene #61622) were mixed with 0.2 µL of lipofectamine 2000 following the transfection method previously described ...
-
bioRxiv - Physiology 2024Quote: ... and mitochondrial redox sensors were obtained from Addgene (plasmid # 102551 ...
-
bioRxiv - Cell Biology 2022Quote: A His-tagged mouse Capping Protein (F-actin-capping protein subunit alpha-1 and F-actin-capping protein subunit beta) plasmid was obtained from Addgene as described above (Plasmid #89950) ...
-
bioRxiv - Cell Biology 2020Quote: HeLa cells were cultured and co-transfected with the mTORC1 biosensor TORCAR (pcDNA3-TORCAR; a gift from Jin Zhang (#64927, Addgene))19 and GFP-paxillin ...
-
bioRxiv - Neuroscience 2023Quote: ... and the cytosolic reporter tandem tomato (tdTomato) under the CAG promoter (#83029, Addgene). The plasmids were combined in the following amounts ...
-
bioRxiv - Biochemistry 2023Quote: The Homo sapiens EHMT1 catalytic subunit (Addgene plasmid #51314) and H ...
-
bioRxiv - Biophysics 2024Quote: ... and γ subunits were gifts from Christie Thomas (Addgene plasmid # 83430 ...
-
bioRxiv - Cell Biology 2021Quote: To determine the cytosolic volume of all cell lines pEGFP-N1 (Addgene# 6085-1) was transiently overexpressed ...
-
bioRxiv - Cell Biology 2021Quote: The genes encoding cytosolic and mitochondrial matrix-targeted roGFP (33) were recloned from Addgene vectors 49435 and 49437 into pcDNA5FRT/TO and transfected into Flp-In T-REx 293 cells (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... or GRABDA DA sensor (AAV9-hSyn-GRAB-DA2m; Addgene # 140553; (33)) using the following stereotaxic coordinates ...
-
bioRxiv - Microbiology 2024Quote: ... for the c-di-GMP sensor system purchased from Addgene (#182291), the plasmid origin was substituted with the p15A ori.
-
bioRxiv - Biophysics 2020Quote: The FRET-based VE-Cadherin tension sensor (VE-CadTS: (Addgene Plasmid# 45848) was used to measure tension on VE-cadherin bonds ...
-
bioRxiv - Cell Biology 2021Quote: ... U2OS cells expressing the Mis12-targeted Aurora B FRET sensor (Addgene, #45231) or photoactivatable GFP-α-tubulin (plasmid provided by Alexey Khodjakov ...
-
bioRxiv - Neuroscience 2021Quote: ... The ecAT3.10 sensor was a gift from Mathew Tantama (Addgene plasmid #107215). The SF-iGluSnFR.A184V sensor was a gift from Loren Looger (Addgene plasmid #106175) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PKC sensor pcDNA3-ExRai-CKAR was a gift from Jin Zhang (Addgene plasmid # 118409 ...
-
bioRxiv - Cell Biology 2023Quote: ... The pH sensor superfolder pHluorin (sfpHluorin) amplified from p426MET25-sfpHluorin (Addgene #115697) 43 were expressed from leu1 locus under pil1 promoter.
-
bioRxiv - Neuroscience 2024Quote: We measured dopamine release using fiber photometry and GRABDA sensors (AddGene #140554). We injected AAV9-hsyn-GRAB DA2h to drive expression of the GRAB sensor ...
-
bioRxiv - Cell Biology 2024Quote: Cytosolic NAD+/NADH ratio was measured using a genetically encoded fluorescent NADH biosensor Peredox-mCherry (Addgene, #32383) 50 ...
-
bioRxiv - Cell Biology 2020Quote: ... and K63 only (all lysines except K63 mutated to arginines)(gift from Ted Dawson; Addgene plasmid numbers – 17608 ...
-
bioRxiv - Neuroscience 2021Quote: The pm-iATPSnFR1.0 sensor was a gift from Baljit Khakh (Addgene plasmid #102548). The ecAT3.10 sensor was a gift from Mathew Tantama (Addgene plasmid #107215) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SF-iGluSnFR.A184V sensor was a gift from Loren Looger (Addgene plasmid #106175). The Rncp-iGluSnFR sensor was a gift from Robert Campbell (Addgene plasmid #107336 ...
-
bioRxiv - Neuroscience 2021Quote: ... The Rncp-iGluSnFR sensor was a gift from Robert Campbell (Addgene plasmid #107336) and was subcloned into the pAAV-hSyn vector ...
-
bioRxiv - Cell Biology 2024Quote: Plk1 FRET sensor c-jun substrate was a gift from Michael Lampson (Addgene plasmid #45203 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The CDK1 FRET sensor was a gift from Jonathon Pines (Addgene plasmid # 26064). They were subcloned in the pCDNA 3.1 vector containing a T7 promoter and the constancy was confirmed via DNA sequencing ...
-
bioRxiv - Neuroscience 2024Quote: To induce expression of the calcium sensor GCaMP6f (pENN.AAV1.CamKII.GCaMP6f.WPRE.SV40; Addgene cat# 100834) was unilaterally injected in MD (200 μL ...
-
bioRxiv - Cell Biology 2021Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene 53755-53762) (73) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the epsilon subunit of the bacterial FoF1-ATP synthase cDNA (Addgene plasmid #113906) was inserted into mTQ2-pRSET-A plasmid at Tyr-145 (between the KpnI and EcoRI restriction sites ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR1 subunit tagged with an enhanced yellow protein (EYFP) (Addgene plasmid #17928 ...
-
bioRxiv - Biochemistry 2024Quote: Exocyst subunit plasmids were a kind gift from Channing Der (Addgene #53755-53762). Each was subcloned into FlexiBAC SF9 expression plasmids61 ...
-
bioRxiv - Developmental Biology 2024Quote: ... we used the PIP-FUCCI sensor by Grant et al.21 (Addgene plasmid #118621) and amplified it with overlaps for a piggyBAC vector45 containing a CAG promoter and a puromycin resistance cassette ...
-
bioRxiv - Neuroscience 2020Quote: ... GABA (A) receptor subunit a1SE was a gift from Tija Jacob & Stephen Moss (Addgene plasmid # 49168 ...
-
bioRxiv - Cancer Biology 2023Quote: Each individual Mediator subunit was cloned and expressed in a pLIB plasmid (Addgene #80610). MED12 ...
-
bioRxiv - Physiology 2024Quote: ... encoding the NMDAR-NR2B subunit tagged with an enhanced green fluorescent protein (EGFP) (Addgene plasmid #17925 ...
-
Sexual dimorphism of insular cortex function in persistent alcohol drinking despite aversion in micebioRxiv - Neuroscience 2023Quote: A viral vector coding for the calcium sensor GCaMP6f (AAV9-CaMKII-GCaMP6f-WPRE-SV40, Addgene) was injected unilaterally (250 nl ...
-
bioRxiv - Neuroscience 2024Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Immunology 2021Quote: ... Plasmid encoding EGFP-tagged PP1 catalytic subunit γ was obtained from Addgene (Addgene plasmid # 44225). Expression of PTSN was silenced in U2-OS and 293A cells by lentiviral transduction of a pLKO1 shRNA against both β- and α-PTSN (TRCN0000282572 ...
-
bioRxiv - Cell Biology 2022Quote: ... YFP was inserted into TM3-TM4 intracellular loop of the α4 subunit (Addgene, catalog #: 15245), and cerulean (a CFP variant ...
-
bioRxiv - Cell Biology 2021Quote: The genetically encoded calcium sensor pRSET-RcaMP1h was a gift from Loren Looger (Addgene plasmid # 42874). The coding sequence of the RcaMP1h sensor was subcloned into the pShuttle vector ...