Labshake search
Citations for Addgene :
451 - 500 of 691 citations for Cyclic GMP Direct ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... and rbcS-E9 enhancers and their 169-bp 3′ and 5′ segments as well as the 35S enhancer were PCR amplified from pZS*11_4enh (Addgene no ...
-
bioRxiv - Cancer Biology 2023Quote: ... The top 5 crRNA spacer sequences were selected and cloned into the pX459v2 Cas9 Puro Plasmid (Addgene Plasmid #62988) using single-step golden-gate cloning ...
-
bioRxiv - Neuroscience 2023Quote: ... a guide sequence targeting exon 4 and 5 was cloned in the pSpCas9(BB)-2A-Puro construct (Addgene 48139). For βTC3 cells ...
-
bioRxiv - Cell Biology 2023Quote: ... JR20s were used to express Cas9 and sgRNA (5’-TCGACAGCCTTATGGCGGAC-3’) targeting mouse PFN1 25 from pLentiCRISPRv2 (Addgene #52961) by lentiviral transduction ...
-
bioRxiv - Neuroscience 2020Quote: ... The plasmid kit used for the generation of TALENs was a gift of Daniel Voytas and Adam Bogdanove (Addgene kit #1000000016). Plasmid encoding assembled TALENs was linearized with SacI ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP tagged OsHIPP19 and OsHIPP20 were generated by Golden Gate methods (Engler et al. 2008) using MoClo Plant Parts Kit and MoClo Plant Tool Kit (Addgene, UK). OsHIPP19 and OsHIPP20 were cloned into pICH47732 with a GFP tag at the N-terminus ...
-
bioRxiv - Neuroscience 2022Quote: ... we cloned the dgn-1 promoter and AcNPV p10 3’UTR into the vector pPD49.26 (from the Andrew Fire plasmid kit, Addgene Kit #1000000001) to generate plasmid pNTC2 ...
-
bioRxiv - Cell Biology 2023Quote: ... were constructed in according to Golden Gate TALEN assembly protocol and using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene, Kit #1000000024). CIscript-GoldyTALEN was a gift from Daniel Carlson & Stephen Ekker (Addgene ...
-
bioRxiv - Plant Biology 2024Quote: ... Plasmid construction was performed by modular cloning using the MoClo Tool Kit and the MoClo Plant Parts Kit (Addgene, 28–30). A detailed MoClo protocol and the list of vectors used can be found in 18.
-
bioRxiv - Biochemistry 2024Quote: Plasmids encoding GPCRs were obtained from various sources (as indicated Key Resources Table) or subcloned into pcDNA3.1 from the PRESTO-Tango GPCR kit (Addgene Kit #1000000068) as described next ...
-
bioRxiv - Bioengineering 2019Quote: cDNA for pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau and Paul Kaufman (Addgene plasmid #1744856). To generate lentivirus ...
-
bioRxiv - Cell Biology 2020Quote: ... designed by Life technologies to target the second exon of murine Vangl2 (gRNA: 5’-TCGGCTATTCCTACAAGTC-3’) into pSpCas9(BB)-2A-GFP (PX458, Addgene #48138). Upon transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following guides 5’-GGACCTGTTCGGAATCCACC-3’ and 5’-GGGTGAGGTTCTGTCTACCC-3 were separately cloned into the BbsI site of pU6-BbsI-chiRNA plasmid (obtained from Addgene) and both were simultaneously injected by Best Gene into w1118 ...
-
bioRxiv - Molecular Biology 2020Quote: The gRNA sequence: 5’-TTAAAGAGTAACTACCAACT-3’ targeting the mouse Xpo7 gene was cloned into the PX459 plasmid (Addgene #62988, (23)) ...
-
bioRxiv - Genomics 2020Quote: ... and a revers primer (5′-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-GTGTCTCAAGATCTAGTTACGCCAAGC-3′) were used to amplify 222 bp fragments from CROPseq-Guide-Puro plasmids (#86708, Addgene) which have been inserted with different gRNA sequences ...
-
bioRxiv - Developmental Biology 2019Quote: The construction of a plasmid driving expression of green fluorescent protein (GFP) using a 1kb zebrafish αA-crystallin promoter was previously described [5] and the plasmid is available from Addgene. A second plasmid driving GFP expression with a 296 bp fragment of the human βB1 crystallin promoter was obtained from the Hall laboratory at the University of California at Irvine ...
-
bioRxiv - Molecular Biology 2021Quote: ... or Ring1b (5’-ACAAAGAGTGTCCTACCTGT -3’) were introduced into a modified version of the vector plasmid pX330-U6-Chimeric_BB-CBh-hSpCas9 (Addgene #42230) that yields a BFP marker for selection (Gift by J ...
-
Basolateral amygdala parvalbumin neurons report aversive prediction error to constrain fear learningbioRxiv - Neuroscience 2020Quote: ... AAV5-ef1α-DIO-hChR2(H134R)-eYFP (5.5×1012 GC/ml) (pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA was a gift from Karl Deisseroth (Addgene viral prep # 20298-AAV5 ...
-
bioRxiv - Cell Biology 2021Quote: ... For CRISPR Cas9 KO generation two gRNA directed to exon 4 and exon 5 (Table M1) were cloned in pSpCas9 (BB)-2A-Puro V2.0 (Addgene #62988).
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of pEA216-1 was then co-transfected with 5 μg of the pCMVΔR8.2 helper plasmid (Addgene Plasmid #122263) and 1 μg of pHEF-VSV-G into 70% confluent monolayers of 293T cells in a 10 cm dish using polyethylenimine (Polysciences Inc ...
-
bioRxiv - Microbiology 2019Quote: ... full length VPA0226 was amplified using primers 3’ GATC AGATCT ATGATGAAAAAAACAATCACACTA 5’ and 5’ GATA GAATTC G GAAACGGTACTCGGCTAAGTTGTT 3’ and cloned in frame with GFP into the expression vector sfGFP-N1 (41) (Addgene) between BglII and EcoRI sites for the expression of C terminally tagged VPA0226 ...
-
bioRxiv - Cell Biology 2021Quote: ... a single guide RNA (sgRNA) targeting exon 4 of TP53 (5’-CTGTCATCTTCTGTCCCTTC-3’) was cloned into pSpCas9(BB)-2A-GFP (pX458, plasmid #48138, Addgene). pSpCas9(BB)-2A-GFP was a kind gift from dr ...
-
bioRxiv - Cell Biology 2021Quote: ... the fragments of 5’ and 3’ homology arms to target ROSA26 locus were subcloned into H2B-670 (modified from pmiRFP670-N1, #79987, Addgene) or FUCCI (kind gift from Ludovic Vallier’s lab ...
-
bioRxiv - Cell Biology 2021Quote: ... the fragments of 5’ and 3’ homology arms to target AAVS1 locus were subcloned into hOCT4 promoter containing phOCT4-EGFP plasmid (#38776, Addgene) using AAVS1 SA-2A-puro-pA donor plasmid (#22075 ...
-
bioRxiv - Cell Biology 2021Quote: ... The fragments of 5’ and 3’ homology arms of ORACLE-OCT4 (exo) were replaced using human OCT4-2a-eGFP-PGK-Puro (#31938, Addgene) to target endogenous OCT4 locus with modification ...
-
bioRxiv - Neuroscience 2022Quote: ... cultures were infected at 5 days in vitro (DIV) with titer-matched viruses using pAAV-Syn-ChrimsonR-tdT (Addgene #59171) and pAAV2.5-TH-GFP (Addgene #80336) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Reverse: 5’-AAAC-(N)19-20-3’) were designed and cloned in a zebrafish U6 promoter-driven vector (Addgene#64245) at BsmBI restriction sites according to the previous study (Jao et al. ...
-
bioRxiv - Molecular Biology 2022Quote: ... dsDNA repair templates were amplified using primers with 5’ SP9 modifications (IDT) from the pJRK86 plasmid (AID*::GFP, Addgene #173743) and mIAA7 repair template plasmids in table 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... Figs. 4A-C, 5, and 7B,C, and Supplementary Movies 1,2; Salk Vector Core; 2.5 x 1012; Addgene plasmid #50973); AAV1-hSyn-SIO-stGtACR2-FusionRed (Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 nM or 37.5 nM of preincubated binary complexes were added to 5 nM of target DNA (eGFP-hAgo2 plasmid (Addgene #21981) linearized with SmaI) ...
-
bioRxiv - Neuroscience 2022Quote: ... For the chemogenetic activation of 5-HT2cR we used AAV8-hSyn-DIO-hMD3q-mCherry and AAV8-hSyn-DIO-mCherry (UNC, Addgene). For the silencing of GLP1R mRNA we used AAV1.U6.shRGlp1r07.CB7.EGFP.SV40 (AAV1-shRNA-Glp1r ...
-
bioRxiv - Developmental Biology 2022Quote: ... The empty ctrl or MMP14-eGFP lentiviral plasmid (7.5 μg) was co-transfected into 293 cells with packaging plasmid pRSV-Rev (5 μg, Addgene #12253), pMDLg/pRRE (2.5 μg ...
-
bioRxiv - Genetics 2022Quote: ... with 5’ KpnI and 3’ EcoRI sites (primers LC127 and 128) into the corresponding restriction digestion sites of pLP9 (Addgene plasmid #1497 ...
-
bioRxiv - Neuroscience 2019Quote: In some PV-IRES-Cre mice ChR2 was introduced by injecting 50 nL of AAV2/5-hSyn1-FLEX-hChR2-tdTomato (Addgene plasmid 41015 ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The human codon-optimized Cas9 coding sequence including two nuclear localization signals (SV40 NLS at the 5’ and nucleoplasmin NLS at the 3’) was amplified from hcas9 (a gift from George Church; Addgene plasmid # 41815 ...
-
bioRxiv - Neuroscience 2021Quote: Cre-dependent adeno-associated virus (AAV; serotypes 5 or 9) was used to express GCaMP6s (AAV5-Syn-Flex-GCaMP6s, Addgene), or GCaMP7f (AAV9-Syn-Flex-jGCaMP7f-WPRE ...
-
bioRxiv - Immunology 2021Quote: ... par-5 and his-1 cDNA were subcloned into pCE-BiFC-VN173 and pCE-BiFC-VC155 plasmids (Addgene, Cambridge, MA), which contain the heat shock promoter Phsp-16.41 ...
-
bioRxiv - Biochemistry 2020Quote: ... we used plasmids encoding hDicer 3’-pocket double mutant (Y926F, R927A), and the 5’-pocket sextuple mutant (R778A, R780A, R811A, H982A, R986A, R993A) (23) (Addgene). PCR fragments were subsequently cloned into the pMCSG7 vector (courtesy of Laboratory of Protein Engineering ...
-
bioRxiv - Microbiology 2020Quote: The integrins subunits were overexpressed in CHO cells line with the following plasmids: Alpha 5 integrin-GFP (Addgene plasmid# 15238)50 ...
-
bioRxiv - Microbiology 2020Quote: The nucleic acid sequences of N-terminal adhesin domains of CfaE and class 5 adhesins (GenBank M55661) were cloned into a pMAL-C5X vector (Addgene) in-frame with an MBP tag to express as periplasmic proteins with improved solubility (MBP–CfaE-N) ...
-
bioRxiv - Immunology 2021Quote: ... the short guide RNAs (sgRNAs) targeting the signaling peptide (5’-GAGTAGCGCGAGCACAGCTA - 3’) was cloned into lentiCRISPR v2 (a gift from Feng Zhang; Addgene plasmid # 52961 ...
-
bioRxiv - Immunology 2022Quote: ... HHLA2 cDNA included 5’ EcoRI and 3’ NotI sites and was cloned into the pBMN-IRES-GFP vector (Addgene #1736). PCR (Q5 enzyme ...
-
bioRxiv - Immunology 2022Quote: ... pLenti CMV GFP Puro (658-5) was a gift from Eric Campeau & Paul Kaufman (Addgene plasmid # 17448; http://n2t.net/addgene:17448; RRID: Addgene 17448) (40) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Virus was generated by plating 3.5×104 COS1 cells per well in a 6 well plate and transfecting them on the 2nd day with 1 ug total plasmid per well at a 5:3:2 ratio of lentiCRISPR:psPAX2(Addgene #12260):pMD2.G(Addgene#12259 ...
-
bioRxiv - Cell Biology 2023Quote: ... The PAC sgRNA (5′-TGTCGAGCCCGACGCGCGTG-3′) (Lambrus et al., 2016) was cloned into the pSpCas9(BB)-2A-GFP (PX458; 48138; Addgene) vector while the FBXL4 sgRNA-1 (5’-TTGGTCAGAGAGACCTACGA-3’ ...
-
bioRxiv - Microbiology 2023Quote: ... The second 5’-HDNT allele was replaced by a similar puromycin cassette (puro-HSV-TK-loxP) amplified from the pHJ18 plasmid (Addgene) [65] using primers p47/p48 ...
-
bioRxiv - Neuroscience 2023Quote: Ntsr1-Cre mice (n = 3) were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO- stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” 6 weeks prior to the recordings ...
-
bioRxiv - Neuroscience 2023Quote: ... Ntsr1-Cre and Rbp4-Cre mice were stereotaxically injected with an inhibitory opsin (AAV1-hSyn-SIO-stGtACR2-FusionRed, 5 x 1011 vg/ml, Addgene) see “Virus injection and optical fiber implantation” ...
-
bioRxiv - Cell Biology 2023Quote: ... A pair of 20-mer oligonucleotides targeting the 5’ end of the dtat coding sequence was ligated into pAc-sgRNA-Cas9 (Addgene) and validated by sequencing ...
-
bioRxiv - Developmental Biology 2023Quote: ... The guide sequence used was 5’-TCTCTGAGTGCCAACGCGCG-3’ and was cloned into the BbsI site of pX459 vector (Addgene #62988). The gene targeting was performed by co-transfection of pX459 and the synthetic donor vector into B6N 6.0 embryonic stem cells using Lipofectamine 2000 ...