Labshake search
Citations for Addgene :
151 - 200 of 1845 citations for Cow Fibrinogen Like Protein 1 FGL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... The Spike protein from pcDNA3.1-SARS2-Spike was a gift from Fang Li (Addgene plasmid # 145032 ...
-
bioRxiv - Microbiology 2021Quote: ... A VSV G protein expression plasmid was obtained from Addgene (Watertown, MA; Cat.# 8454).
-
bioRxiv - Neuroscience 2022Quote: ... The recombinant AAV vector was pseudotyped with AAV5 capsid protein and packaged by Addgene.
-
bioRxiv - Neuroscience 2023Quote: ... and green fluorescent protein (pAAV2-hSyn-eGFP, Addgene #50465, 2.2 x 1013 GC/ml) under the human synapsin promoter were obtained from Addgene ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmids for SARS-CoV-2 structural proteins were purchased from Addgene (Appendix Table 2). Lentiviral supernatant was collected according to the manual using 293FT cells ...
-
bioRxiv - Molecular Biology 2023Quote: ... CAST I-B system’s proteins and inverted repeat constructs were sub-cloned from Addgene plasmids #168137 and #168146 to generate pIF1003.
-
bioRxiv - Neuroscience 2023Quote: ... Control mice were infused with a red fluorescent protein (excitation: AAV8-Ef1a-mCherry, Addgene #114470 ...
-
bioRxiv - Immunology 2023Quote: ... Plasmids encoding ancestral and variant SARS-CoV-2 spike protein were purchased from Addgene (170442 ...
-
bioRxiv - Microbiology 2023Quote: ... plasmid containing human codon-optimized Streptococcus pyogenes Cas9 protein and Stk3 (Mst2, Addgene #75975) gRNA was used to dually target Mst1 and Mst2 ...
-
bioRxiv - Synthetic Biology 2023Quote: The CIDAR MoClo Parts Kit was a gift from Douglas Densmore (Addgene kit # 1000000059). CIDAR MoClo Extension ...
-
bioRxiv - Biochemistry 2022Quote: ... The PRESTO-Tango plasmid kit was a gift from Bryan Roth (Addgene kit # 1000000068).
-
bioRxiv - Synthetic Biology 2023Quote: ... The MoClo-YTK plasmid kit was a gift from John Dueber (Addgene kit # 1000000061). Enzymes used were from New England Biolabs unless stated otherwise ...
-
bioRxiv - Molecular Biology 2023Quote: The CRISPaint gene tagging kit was a gift from Veit Hornung (Addgene kit # 1000000086). To generate a targeting construct for AGO2 ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... All GPCR plasmids originated from the Roth lab PRESTO-Tango kit (Addgene, Kit #1000000068) and were amplified in E ...
-
bioRxiv - Neuroscience 2020Quote: ... Feng Zhang (Addgene kit #1000000019). Once assembled into a destination vector ...
-
bioRxiv - Bioengineering 2021Quote: ... The GoldenPiCS Kit was a gift from the Gasser/Mattanovich/Sauer group (Addgene kit #1000000133). All coding sequences were amplified with high-fidelity Phusion DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... Basic DNA parts were selected from GoldenBraid 2.0 kit from Diego Orzaez (Addgene kit # 1000000076) or MoClo Toolkit ...
-
bioRxiv - Developmental Biology 2023Quote: TALEN plasmids were constructed using the Platinum Gate TALEN Kit (Kit #1000000043, Addgene, Cambridge, MA) as previously described (Sakuma et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... the Pro251 allele was inserted into the green fluorescent protein (GFP)-PLIN2 plasmid (Addgene #87161). Sequences were verified in forward and reverse directions using primers EGFP-N and SV40pA-R ...
-
bioRxiv - Neuroscience 2020Quote: ... and the fluorescent protein cDNA for tagBFP was cloned from pdCas9::BFP-humanized (Addgene, #44247). A zebra finch FoxP2 cDNA clone provided by Erich Jarvis was subcloned into pLenti6.4 using a gateway reaction ...
-
bioRxiv - Biophysics 2020Quote: ... final protein expression constructs were generated by Gateway LR recombination into pDest-566 (Addgene #11517), an Escherichia coli T7–based expression vector based on pET42 and incorporating hexa-histidine (His6 ...
-
bioRxiv - Biophysics 2022Quote: ... pET19b:EcMscLGFP was used previously as an in vitro membrane protein folding reporter (Addgene plasmid # 165097) (Jacobs et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... Expression constructs for various cytoskeleton or organelle marker proteins were obtained from Addgene (S1 Table). For bacterial expression of His6-tagged CAHS proteins ...
-
bioRxiv - Cell Biology 2021Quote: MSCs were transduced with lentiviral particles having mitochondria targeting protein and GFP in downstream (Addgene) and lysosome were stained with lysotracker Deep-Red (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: HEK293T cells were transfected with an inducible nuclear-localized HT protein (HT-NLS, Addgene #82518). Doxycycline (DOX ...
-
bioRxiv - Neuroscience 2021Quote: ... enhanced yellow fluorescent protein (eYFP) or the single guide RNA (sgRNA) that cleaves KV3.4/KCNC4: pENN.AAV.CAG.tdTomato.WPRE.SV40 (Addgene #105554), pAAV.CamKII(1.3).eYFP.WPRE.hGH (Addgene #10522) ...
-
bioRxiv - Cell Biology 2020Quote: ... or a fluorescent protein (pCDNA3-GFP; Addgene plasmid #74165 or mCherry2-N1; Addgene plasmid #54517) was used to transfect HEK-293 cells at 70-90% confluency using Lipofectamine 3000 reagent (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... an artificial transposon with all of the attributes of a protein expression vector (Addgene #120863), and 1 unit of MuA transposase (Thermo Fisher Scientific ...
-
bioRxiv - Synthetic Biology 2020Quote: The extracellular domain of ASLV-A envelope protein from the plasmid pAAV-TRE-HTG (Addgene) and the targeting domain encoding the Gbp6 nanobody33 were combined by PCR and cloned into a Piggybac transfer vector under a synthetic constitutive promoter (Supplementary Table 1) ...
-
bioRxiv - Immunology 2022Quote: MSP2N2-His6 protein (45) was expressed by transforming BL21 DE2 cells with pET28-MSP2N2 (Addgene). Cells were grown to a OD600 of ~0.8 in the presence of 50 μg/mL of kanamycin and induced for 3 hours with 0.5 mM isopropy β-D-1-thiogalactopyranoside (IPTG) ...
-
bioRxiv - Microbiology 2022Quote: ... to co-transfect plasmids containing cDNAs for SARS-CoV-2 E protein (pGBW-m4133502, Addgene) and green fluorescent protein (GFP ...
-
bioRxiv - Molecular Biology 2022Quote: Plasmid pET28HIS-hAPE1 (for WT His-APE1 protein) was a gift from Primo Schaer (Addgene plasmid #70757 ...
-
bioRxiv - Microbiology 2023Quote: HEK293 cells expressing transiently-transfected actin fused to monomeric azure-fluorescent protein (mAzure-Actin; Addgene) were grown on coverslips in 12-well plates at 2×105 cells/well and infected with Bp340 ...
-
bioRxiv - Neuroscience 2023Quote: ... Chimeric G proteins for the Gsx assay 44 were obtained from Addgene (Watertown, MA, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... or Wnt7a-BioID2 fusion proteins were generated using the mycBioID2-pBABE-puro vector (Addgene Plasmid). Myoblasts were grown in 15 cm culture dishes at sub confluency and incubated with biotin (Sigma-Aldrich ...
-
bioRxiv - Biophysics 2023Quote: TIA1 proteins were expressed in the BL21DE3 bacterial cell line from the pET28b plasmid (Addgene) containing the Mus musculus (mouse ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.85 μg pVSV-G (Expresses VSV-G envelop protein for pseudotyping NanoMEDIC particle, Addgene #138479) (46) ...
-
bioRxiv - Neuroscience 2023Quote: ... USA) and [2] a Cre-dependent virus expressing green fluorescent protein (AAV-Flex-GFP; Addgene) or diphteria toxin (AAV2/9-EF1a-mCherry-Flex-dTA ...
-
bioRxiv - Cell Biology 2023Quote: ... Both GFP11-tagged Fluc proteins and GEM transcriptional factor (cloned from pJW1663, Addgene plasmid #112037) were stably integrated into yeast genome ...
-
bioRxiv - Cell Biology 2023Quote: ... a vector expressing dCas9-VP64 fusion protein based on pCMV-SpdCas9-VP64 (Addgene plasmid # 115794), a gift from Nadav Ahituv 62 ...
-
bioRxiv - Bioengineering 2023Quote: ... a red fluorescent calcium sensor protein (RCaMP) was amplified from pAAV.Syn.Flex.NES-jRGECO1a.WPRE.SV40 (Addgene cat#100853) using primers 5’-ACTAGTATGCTGCAGAACGAGCTTGC and ACCGGTCTACTAGTCTCAATTGTCACTTCGCTGTCATCATTTGT ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed 1:1 with pAAV.CAMKII.Cre.SV40 (#105558; Addgene), or pAAV.CAG.GFPsm-myc.WPRE.SV40 (#98926 ...
-
bioRxiv - Neuroscience 2020Quote: The TALEN kit used for TALE assembly was a gift from Keith Joung (Addgene kit # 1000000017). DNA fragments encoding ROSA TALEN repeat arrays were cloned into plasmid pJDS71 ...
-
bioRxiv - Plant Biology 2024Quote: We used zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 (AddGene #1000000171). Sequence of all oligonucleotides and PCR primers used in this study are provided in Table S1 ...
-
bioRxiv - Plant Biology 2020Quote: ... from Sylvestre Marillonnet (Addgene kit # 1000000044). Specific parts (target gRNA or siRNA sequence ...
-
bioRxiv - Synthetic Biology 2022Quote: The MoClo Toolkit (Addgene Kit #1000000044), MoClo Plant Parts Kit (Addgene Kit #1000000047) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... GreenGate Cloning System (Addgene Kit #1000000036) and amilCP_Orange chromoprotein vector (Addgene Plasmid #117850 ...
-
bioRxiv - Genetics 2023Quote: ... and pX330S-2 (Addgene Kit 1000000055) according to the kit instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... including existing parts (Addgene Kit # 1000000080) and custom-made parts (Table 2) ...
-
bioRxiv - Biochemistry 2024Quote: ... a ∼1:1:1 molar ratio mixture of library transfer (lentiCRISPRv2; Addgene plasmid #52961) and packaging plasmids (psPAX2 ...