Labshake search
Citations for Addgene :
201 - 250 of 696 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: mApple-Alpha-5-Integrin-12 was a gift from Michael Davidson (Addgene plasmid # 54864 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 5 μg of PMD2.G envelope– expressing plasmids (no. 12259, Addgene) were diluted in 500 μl of jetPRIME buffer (no ...
-
bioRxiv - Physiology 2023Quote: ... pAAV-GfaACC1D.Lck-GCaMP6f.SV40 (1.53×1013 vg/ml, working dilution 1:5, Addgene plasmid #52925-AAV5 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 µl of AAV9.CAG.GCaMP6s.WPRE.SV40 or AAV9.syn.GCaMP8s-WPRE virus (Addgene, USA) was injected subcutaneously in the nape of the neck ...
-
bioRxiv - Neuroscience 2023Quote: PV-IRES-Cre animals injected with AAV2/5.EF1a.Dio.hChR2(H134R)-eYFP.WPRE.hGH (Addgene, titer ≥ 1×10¹³ vg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... tFucci(CA)5 was a gift from Atsushi Miyawaki (Addgene plasmid # 153521).
-
bioRxiv - Immunology 2023Quote: ... and 5 ug pCMV-VSV-G (kind gift from Bob Weinberg (Addgene plasmid #8454 ...
-
bioRxiv - Neuroscience 2023Quote: ... top 5 sgRNAs/gene library was gift from Jonathan Weissman (Addgene #83969) (20) ...
-
bioRxiv - Neuroscience 2024Quote: AAV serotype 5 EF1a-DIO-YFP (1.3 × 1013 gp/mL) (Addgene #27056)
-
bioRxiv - Neuroscience 2024Quote: ... c-Myc-5-HT2A was a gift from Javier Gonzalez-Maeso (Addgene plasmid # 67944 ...
-
bioRxiv - Cancer Biology 2024Quote: ... SEPSECS: 5’-AACCGCGAGAGCTTCGCGG-3’ were cloned into lentiCRISPRv2 vector (Addgene, Plasmid #52961) using BsmBI restriction sites ...
-
bioRxiv - Genomics 2022Quote: ... elegans Vector Kit was a gift from Andrew Fire (Addgene kit # 1000000001). A translational reporter was later generated by synthesizing the remainder of the coding sequence (IDT ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 µg psPAX2 (psPAX2 was a gift from Didier Trono; Addgene plasmid # 12260) and 2 µg VSVg were mixed with 30 µL X-tremeGene9 transfection reagent (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... sgFLI_Ex9 (5’-GCCTCACGGCGTGCAGGAAG-3’) was cloned into lentiCRISPR v2-Blast vector (Addgene, #83480) using BsmbI restriction sites ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The module 5 was taken from the pAJM.847 plasmid in (41) (Addgene #108524 ...
-
bioRxiv - Genomics 2020Quote: ... EF06R (5’UTR-LINE-1) was a gift from Eline Luning Prak (Addgene plasmid # 42940 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and a WPRE (cloned from pLenti CMV GFP Puro (658-5) (Addgene #17448)) all flanked by epigenetic insulator sequences by repetitive restriction digests (KflI-EcoRI ...
-
bioRxiv - Neuroscience 2022Quote: ... AAV1-hSyn-Cre-WPRE-hGH (Addgene, 10^13 gc/ml, diluted 1:5), AAV5-CAG-FLEX-tdtomato (UNC Viral Core ...
-
bioRxiv - Developmental Biology 2022Quote: ... a p21 sgRNA (5’-GATTGCGATGCGCTCATGGC-3’) was cloned into the px330 vector (Addgene). ESCs were co-transfected with 2μg of this vector and 0,12μg of an hygromycin marker (#631625 ...
-
bioRxiv - Neuroscience 2022Quote: ... unique sgRNA (5’-CACCGGGACATAGTATTTGAAAGAC-3’) was cloned into lenti-CRISPRv2 construct (Addgene #52961), which expresses Cas9 and puromycin cassette ...
-
bioRxiv - Neuroscience 2022Quote: A viral cocktail containing AAV2/5.GfaABC1D GCaMP6f (3 × 1012 gc/ml, Addgene) for astrocyte Ca2+ detection or AAV9.hSyn.GCaMP6f (3 × 1012 gc/ml ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: 1-5 μg of CS2-plasmid containing the ORF for Cas9 (Addgene #51307) or H2B-RFP was linearized by Not1 endonuclease digestion ...
-
bioRxiv - Neuroscience 2020Quote: ... pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 virus (500 nL, titer ≥ 1X1013 vg/mL, working dilution 1:5, Addgene, #100833-AAV9 ...
-
bioRxiv - Immunology 2021Quote: ... pLenti-GFP (Core with 5’ and 3’ LTR) was also from Addgene (#17448) and the plasmids containing Tat1b and Rev1b (SARS-Related Coronavirus 2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 μg pMDLg/RRE and 2.5 μg pRSV-REV (Addgene #14888, #12251, #12253) using calcium phosphate ...
-
bioRxiv - Cell Biology 2022Quote: ... The hCRISPRi-v2 compact library (5 sgRNAs per gene, Addgene pooled library #83969) was transduced in duplicate into 330 million K562-CRISPRi-Tet-ON-((MICU1)-GFP1-10)-(tet-RFP-P2A-OMP25-GFP11 ...
-
bioRxiv - Neuroscience 2023Quote: ... AAV9-hSyn- GrabDA1h (n = 5 Area X hemispheres; n = 2 MST hemispheres; Addgene), AAV5-CAG- Dlight1.1 (n = 1 Area X hemisphere ...
-
bioRxiv - Cell Biology 2023Quote: ... 5*10^10 genomic copies of commercially produced AAV8-TBG-Cre (Addgene #107787) or control AAV8-TBG-GFP (Addgene #105535 ...
-
bioRxiv - Developmental Biology 2023Quote: ... Bot oligo – 5’-aaacTTGGCACTCCATTAGATCCG-3’) were cloned into U6.3>gRNA.f+e (#99139, Addgene) and electroporated at a concentration of 1.5 ug/ul ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- CCACCTCAACGTCAGGGTGC) was cloned into LentiCRISPRv2 vector (Addgene, 52961). Lentivirus carrying CRISPR/Cas9-PARP1 guide was transduced to HCT116 in the presence of 8 μg/ml polybrene ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting ATP6V1B2 (5’- AAACTTACCATCATTAGGCA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tacatgtatacagatttagccacgatatatgaacgcgctgggcgagtggaagggagaaacggctcgattactcaaatccctattctGacAatgcctaatA atggtaagttttggtatttggattataacacacctaatcattttaaagagagagaagacccatctaccttttcgagttgaagttattttgagaacacatc using TransIT-LT (Mirus) ...
-
bioRxiv - Biochemistry 2023Quote: Guide RNA targeting PARP1 (5’- AAACATGTAGCCTGTCTGGA) was cloned into pX330 vector (Addgene, #42230). HCT116 cells were transfected with the guide RNA and single-stranded oligo 5’- tcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccagacaggctacatgtttggtaaagggatcta tttcactgatatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatcctgttgggagaagttgcccttggaaacatgtg agt for A898T mutation and 5’- tggcactcagtgaacagctgctcctaatttcccatcagaagattctcagctctcccttttccgaccttccag acaggctacatgtttggtaaaggaatctgtttcgctgacatggtctccaagagtgccaactactgccatacgtctcagggagacccaataggcttaatc ctgttgggagaagttgcccttggaaacat for Y896C mutation using TransIT-LT (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mixed at a 5:1 ratio with pCMV(CAT)T7-SB100 (Addgene #34879), and co-transfected to HEK293T cells using TransIT-293 (Mirus) ...
-
bioRxiv - Neuroscience 2023Quote: ... mice were injected with 0.5 µl of AAV2/5-CaMKIIα-GCaMP6f (Addgene, #100834) into the vH (AP -3.28 mm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of VSV-G envelope expressing plasmid pMD2.G (Addgene #12259) were co-transfected into HEK293T cells using calcium phosphate transfection ...
-
bioRxiv - Molecular Biology 2023Quote: ... to remove the neomycin selection cassette or both 5 μg pFlpO (Addgene #13792) and 5 µg of pCrePac(Taniguchi ...
-
bioRxiv - Neuroscience 2023Quote: The following viruses were used: AAV2/5-ef1alpha-FLEX-taCasp3-TEVp (Addgene, 45580) and AAV2/1-CAG-FLEX-EGFP-WPRE (Addgene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... We used DNA parts provided with the EMMA cloning kit (Addgene kit # 1000000119) and generated DNA fragments by PCR using Platinum™ SuperFi II Green PCR Master Mix (ThermoFisher ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10cm plate) cells were transfected using PEI with psPAX2 (3.5µg, a gift from Didier Trono, Addgene #12260), pMD2.G (1.5µg ...
-
bioRxiv - Molecular Biology 2020Quote: ... NPCs were seeded onto laminin-coated plates and transduced by spinfection43 with CMV-rtTA (Addgene ID: 19780) and TetO-NGN2-P2A-Puro (Addgene 79049) ...
-
bioRxiv - Molecular Biology 2023Quote: Cells were plated in 10-cm plates and transfected with plasmids expressing His6-SUMO1 (Addgene plasmid # 133770) or His6-SUMO2 (Addgene plasmid # 133771) ...
-
bioRxiv - Neuroscience 2024Quote: 120 000 iPS cells were plated on 12-well plates one day before the transduction by lentiviruses pLV_TRET_hNgn2_UBC_Puro (Addgene: 61474) and pLV_hEF1a-rtTA3 (Addgene:61472 ...
-
bioRxiv - Cancer Biology 2021Quote: ... we cloned Myc-FLAG tagged POT1 into T7 expression vector (pcDNA 5/FRT, Addgene) and performed site-directed mutagenesis ...
-
bioRxiv - Cancer Biology 2021Quote: mRFP-FKBP-5-ptase-dom and PM-FRB-CFP plasmids were obtained from Addgene (deposited by the laboratory of T ...
-
bioRxiv - Cell Biology 2020Quote: ... The cell line carrying the 5’TOP element-containing SunTag reporter (Addgene plasmid #119946) together with scFv-GFP and NLS-stdMCP-stdHalo was described previously (Wilbertz et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA fragment containing 5′-AGCCATGGGAAACATCGCAC-3′ was cloned into pL-CRISPR.EFS.tRFP (Addgene#57819) (Heckl et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μl cold lysisg/μl cold lysisl pCAGG>nls-hCas9-nls-GFP (Addgene #99141) and 3 μl cold lysisg/μl cold lysisl U6.3>Lhx5/Sox1/Six3 gRNA f+e was microinjected together with the Fast Green solution (Sigma ...
-
bioRxiv - Genetics 2020Quote: ... Gal4 5’ and 3’ homology arms were PCR-amplified using pDEST-APIGH (Addgene # 112804) as the template ...
-
bioRxiv - Synthetic Biology 2020Quote: ... the sequence of Francisella novicida cas12a was amplified from pUDC175 (Addgene plasmid #103019, (5)) using primers 13553-13554 ...
-
bioRxiv - Cancer Biology 2021Quote: The Rb1 CRISPR plasmid with gRNA sequence 5-GCTCTGGGTCCTCCTCAGGA-3 (TLCV2-RB1, Addgene#87836) was purchased from Addgene ...